RAB4A cDNA ORF Clone, Mouse, untagged

Cat: MG52504-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All RAB4A Reagents
CRO Services
Product recommended

All RAB4A Reagents
RAB4A cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
657 bp
Description
Full length Clone DNA of Mouse RAB4A, member RAS oncogene family.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RAB4A cDNA ORF Clone, Mouse, untagged Alternative Names
AI848268 cDNA ORF Clone, Mouse;Rab4 cDNA ORF Clone, Mouse
RAB4A Background Information
Full Name
RAB4A, member RAS oncogene family

RAB4A cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RAB4A cDNA ORF Clone in Cloning Vector, Mouse MG52504-G
RAB4A cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52504-ACG
RAB4A Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52504-ACGLN
RAB4A cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52504-ANG
RAB4A cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52504-ACR
RAB4A cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52504-ANR
RAB4A cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52504-CF
RAB4A cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52504-NF
RAB4A cDNA ORF Clone, Mouse, C-His tag MG52504-CH
RAB4A cDNA ORF Clone, Mouse, N-His tag MG52504-NH
RAB4A cDNA ORF Clone, Mouse, C-HA tag MG52504-CY
RAB4A cDNA ORF Clone, Mouse, N-HA tag MG52504-NY
RAB4A cDNA ORF Clone, Mouse, C-Myc tag MG52504-CM
RAB4A cDNA ORF Clone, Mouse, N-Myc tag MG52504-NM
RAB4A qPCR Primer Pairs, Mouse MP202377

RAB4A cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RAB4A cDNA ORF Clone in Cloning Vector, Human HG14610-G
RAB4A cDNA ORF Clone, Human, untagged HG14610-UT
RAB4A cDNA ORF Clone, Human, C-GFPSpark® tag HG14610-ACG
RAB4A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14610-ACGLN
RAB4A cDNA ORF Clone, Human, N-GFPSpark® tag HG14610-ANG
RAB4A cDNA ORF Clone, Human, C-OFPSpark® tag HG14610-ACR
RAB4A cDNA ORF Clone, Human, N-OFPSpark® tag HG14610-ANR
RAB4A cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14610-CF
RAB4A cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14610-NF
RAB4A cDNA ORF Clone, Human, C-His tag HG14610-CH
RAB4A cDNA ORF Clone, Human, N-His tag HG14610-NH
RAB4A cDNA ORF Clone, Human, C-HA tag HG14610-CY
RAB4A cDNA ORF Clone, Human, N-HA tag HG14610-NY
RAB4A cDNA ORF Clone, Human, C-Myc tag HG14610-CM
RAB4A cDNA ORF Clone, Human, N-Myc tag HG14610-NM
RAB4A qPCR Primer Pairs, Human HP103244
info info
添加购物车成功! 添加购物车失败!