RAB3A cDNA ORF Clone, Mouse, untagged

Cat: MG52543-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All RAB3A Reagents
CRO Services
Product recommended

All RAB3A Reagents
RAB3A cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
663 bp
Description
Full length Clone DNA of Mouse RAB3A, member RAS oncogene family.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RAB3A Background Information
Full Name
RAB3A, member RAS oncogene family

RAB3A cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
RAB3A cDNA ORF Clone in Cloning Vector, Rhesus CG90572-G
RAB3A cDNA ORF Clone, Rhesus, untagged CG90572-UT
RAB3A cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90572-ACG
RAB3A Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90572-ACGLN
RAB3A cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90572-ANG
RAB3A cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90572-ACR
RAB3A cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90572-ANR
RAB3A cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90572-CF
RAB3A cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90572-NF
RAB3A cDNA ORF Clone, Rhesus, C-His tag CG90572-CH
RAB3A cDNA ORF Clone, Rhesus, N-His tag CG90572-NH
RAB3A cDNA ORF Clone, Rhesus, C-HA tag CG90572-CY
RAB3A cDNA ORF Clone, Rhesus, N-HA tag CG90572-NY
RAB3A cDNA ORF Clone, Rhesus, C-Myc tag CG90572-CM
RAB3A cDNA ORF Clone, Rhesus, N-Myc tag CG90572-NM

RAB3A cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
RAB3A cDNA ORF Clone in Cloning Vector, Rat RG81357-G

RAB3A cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RAB3A cDNA ORF Clone in Cloning Vector, Mouse MG52543-G
RAB3A cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52543-ACG
RAB3A Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52543-ACGLN
RAB3A cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52543-ANG
RAB3A cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52543-ACR
RAB3A cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52543-ANR
RAB3A cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52543-CF
RAB3A cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52543-NF
RAB3A cDNA ORF Clone, Mouse, C-His tag MG52543-CH
RAB3A cDNA ORF Clone, Mouse, N-His tag MG52543-NH
RAB3A cDNA ORF Clone, Mouse, C-HA tag MG52543-CY
RAB3A cDNA ORF Clone, Mouse, N-HA tag MG52543-NY
RAB3A cDNA ORF Clone, Mouse, C-Myc tag MG52543-CM
RAB3A cDNA ORF Clone, Mouse, N-Myc tag MG52543-NM
RAB3A qPCR Primer Pairs, Mouse MP202416

RAB3A cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RAB3A cDNA ORF Clone, Human, untagged HG18764-UT
info info
添加购物车成功! 添加购物车失败!