PYCR2 cDNA ORF Clone, Mouse, C-HA tag

Cat: MG51873-CY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All PYCR2 Reagents
CRO Services
Product recommended

All PYCR2 Reagents
PYCR2 cDNA ORF Clone, Mouse, C-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
963 bp
Description
Full length Clone DNA of Mouse pyrroline-5-carboxylate reductase family, member 2 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PYCR2 cDNA ORF Clone, Mouse, C-HA tag Alternative Names
1810018M05Rik cDNA ORF Clone, Mouse;P5cr2 cDNA ORF Clone, Mouse
PYCR2 Background Information
Full Name
pyrroline-5-carboxylate reductase family, member 2

PYCR2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PYCR2 cDNA ORF Clone in Cloning Vector, Mouse MG51873-G
PYCR2 cDNA ORF Clone, Mouse, untagged MG51873-UT
PYCR2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51873-ACG
PYCR2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51873-ACGLN
PYCR2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51873-ANG
PYCR2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51873-ACR
PYCR2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51873-ANR
PYCR2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51873-CF
PYCR2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51873-NF
PYCR2 cDNA ORF Clone, Mouse, C-His tag MG51873-CH
PYCR2 cDNA ORF Clone, Mouse, N-His tag MG51873-NH
PYCR2 cDNA ORF Clone, Mouse, N-HA tag MG51873-NY
PYCR2 cDNA ORF Clone, Mouse, C-Myc tag MG51873-CM
PYCR2 cDNA ORF Clone, Mouse, N-Myc tag MG51873-NM
PYCR2 qPCR Primer Pairs, Mouse MP201746

PYCR2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PYCR2 cDNA ORF Clone in Cloning Vector, Human HG17012-U
PYCR2 cDNA ORF Clone, Human, untagged HG17012-UT
PYCR2 cDNA ORF Clone, Human, C-GFPSpark® tag HG17012-ACG
PYCR2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG17012-ACGLN
PYCR2 cDNA ORF Clone, Human, N-GFPSpark® tag HG17012-ANG
PYCR2 cDNA ORF Clone, Human, C-OFPSpark® tag HG17012-ACR
PYCR2 cDNA ORF Clone, Human, N-OFPSpark® tag HG17012-ANR
PYCR2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG17012-CF
PYCR2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG17012-NF
PYCR2 cDNA ORF Clone, Human, C-His tag HG17012-CH
PYCR2 cDNA ORF Clone, Human, N-His tag HG17012-NH
PYCR2 cDNA ORF Clone, Human, C-HA tag HG17012-CY
PYCR2 cDNA ORF Clone, Human, N-HA tag HG17012-NY
PYCR2 cDNA ORF Clone, Human, C-Myc tag HG17012-CM
PYCR2 cDNA ORF Clone, Human, N-Myc tag HG17012-NM
info info
添加购物车成功! 添加购物车失败!