SHP-1 cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG50894-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SHP-1 Reagents
CRO Services
Product recommended

All SHP-1 Reagents
SHP-1 cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1794 bp
Description
Full length Clone DNA of Mouse protein tyrosine phosphatase, non-receptor type 6 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SHP-1 cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
70Z-SHP cDNA ORF Clone, Mouse;hcp cDNA ORF Clone, Mouse;Hcph cDNA ORF Clone, Mouse;me cDNA ORF Clone, Mouse;Ptp1C cDNA ORF Clone, Mouse;PTPTY-42 cDNA ORF Clone, Mouse;SH-PTP1 cDNA ORF Clone, Mouse;SHP-1 cDNA ORF Clone, Mouse
SHP-1 Background Information

PTPN6 is an enzyme which belongs to the protein tyrosine phosphatase (PTP) family. PTPs are signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. N-terminal part of PTPN6 contains two tandem Src homolog (SH2) domains, which act as protein phospho-tyrosine binding domains, and mediate the interaction of PTPN6 with its substrates. PTPN6 is expressed primarily in hematopoietic cells, and functions as an important regulator of multiple signaling pathways in hematopoietic cells. It has been shown that PTPN6 interacts with, and dephosphorylate a wide spectrum of phospho-proteins involved in hematopoietic cell signaling.

Full Name
protein tyrosine phosphatase, non-receptor type 6
References
  • Yu CL, et al. (2000) Cytosolic tyrosine dephosphorylation of STAT5. Potential role of SHP-2 in STAT5 regulation. J Biol Chem. 275(1):599-604.
  • Wu DW, et al. (2000) SH2-Containing protein tyrosine phosphatase-1 (SHP-1) association with Jak2 in UT-7/Epo cells. Blood Cells Mol Dis. 26(1):15-24.
  • Jiao H, et al. (1996) Direct association with and dephosphorylation of Jak2 kinase by the SH2-domain-containing protein tyrosine phosphatase SHP-1. Mol Cell Biol. 16(12):6985-92.
  • SHP-1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    SHP-1 cDNA ORF Clone in Cloning Vector, Mouse MG50894-G
    SHP-1 cDNA ORF Clone, Mouse, untagged MG50894-UT
    SHP-1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50894-ACG
    SHP-1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50894-ACGLN
    SHP-1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50894-ANG
    SHP-1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50894-ACR
    SHP-1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50894-ANR
    SHP-1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50894-CF
    SHP-1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50894-NF
    SHP-1 cDNA ORF Clone, Mouse, C-His tag MG50894-CH
    SHP-1 cDNA ORF Clone, Mouse, N-His tag MG50894-NH
    SHP-1 cDNA ORF Clone, Mouse, C-HA tag MG50894-CY
    SHP-1 cDNA ORF Clone, Mouse, N-HA tag MG50894-NY
    SHP-1 cDNA ORF Clone, Mouse, C-Myc tag MG50894-CM
    SHP-1 qPCR Primer Pairs, Mouse MP200865

    SHP-1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    SHP-1 cDNA ORF Clone in Cloning Vector, Human HG10884-M
    SHP-1 cDNA ORF Clone, Human, untagged HG10884-UT
    SHP-1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10884-ACGLN
    SHP-1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10884-ACG
    SHP-1 cDNA ORF Clone, Human, N-GFPSpark® tag HG10884-ANG
    SHP-1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10884-ACR
    SHP-1 cDNA ORF Clone, Human, N-OFPSpark® tag HG10884-ANR
    SHP-1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10884-CF
    SHP-1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10884-NF
    SHP-1 cDNA ORF Clone, Human, C-His tag HG10884-CH
    SHP-1 cDNA ORF Clone, Human, N-His tag HG10884-NH
    SHP-1 cDNA ORF Clone, Human, C-HA tag HG10884-CY
    SHP-1 cDNA ORF Clone, Human, N-HA tag HG10884-NY
    SHP-1 cDNA ORF Clone, Human, C-Myc tag HG10884-CM
    SHP-1 cDNA ORF Clone, Human, N-Myc tag HG10884-NM
    SHP-1 qPCR Primer Pairs, Human HP100770
    info info
    添加购物车成功! 添加购物车失败!