PTP4A2 cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG52089-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PTP4A2 Reagents
CRO Services
Product recommended

All PTP4A2 Reagents
PTP4A2 cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
504 bp
Description
Full length Clone DNA of Mouse protein tyrosine phosphatase 4a2 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PTP4A2 cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
Prl-2 cDNA ORF Clone, Mouse
PTP4A2 Background Information

PRL-2 (Protein-tyrosine phosphatase of regenerating liver 2), also known as PTP4A2 (Protein tyrosine phosphatase type IVA, member 2), is a member of PTP family and has an important function in controlling cell growth. PRL-2 phosphatases may be multifunctional enzymes with diverse roles in a variety of tissue and cell types. The phosphatase of regenerating liver (PRL) family, comprising PRL-1, PRL-2 and PRL-3, is a group of prenylated phosphatases that are candidate cancer biomarkers and therapeutic targets. PRL-1, PRL-2, and PRL-3 represent a novel class of protein-tyrosine phosphatase with a C-terminal prenylation motif. They are three closely related intracellular enzymes that possess the PTP active site signature sequence CX 5R. The PRL-2 mRNA is elevated in primary breast tumors relative to matched normal tissue, and also dramatically elevated in metastatic lymph nodes compared with primary tumors. PRL-2 plays a role in breast cancer progression. PRL-2 is a pathogenic molecule in hematopoietic malignancies and suggest its potential as a novel therapeutic target.

Full Name
protein tyrosine phosphatase type IVA, member 2
References
  • Akiyama S, et al. (2010) PRL-2 increases Epo and IL-3 responses in hematopoietic cells. Blood Cells Mol Dis. 44(4): 209-14.
  • Hardy S, et al. (2010) Overexpression of the protein tyrosine phosphatase PRL-2 correlates with breast tumor formation and progression. Cancer Res. 70(21): 8959-67.
  • Yuan L, et al. (2007) Differential expression and functional constraint of PRL-2 in hibernating bat. Comp Biochem Physiol B Biochem Mol Biol. 148(4): 375-81.
  • Dumaual CM, et al. (2006) Cellular localization of PRL-1 and PRL-2 gene expression in normal adult human tissues. J Histochem Cytochem. 54(12): 1401-12.
  • Zeng Q, et al. (2000) Prenylation-dependent association of protein-tyrosine phosphatases PRL-1, -2, and -3 with the plasma membrane and the early endosome. J Biol Chem. 275(28): 21444-52.
  • PTP4A2 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    PTP4A2 cDNA ORF Clone in Cloning Vector, Rat RG87630-U
    PTP4A2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG87630-ACGLN

    PTP4A2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    PTP4A2 cDNA ORF Clone in Cloning Vector, Mouse MG52089-G
    PTP4A2 cDNA ORF Clone, Mouse, untagged MG52089-UT
    PTP4A2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52089-ACGLN
    PTP4A2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52089-ACG
    PTP4A2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52089-ANG
    PTP4A2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52089-ACR
    PTP4A2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52089-ANR
    PTP4A2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52089-CF
    PTP4A2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52089-NF
    PTP4A2 cDNA ORF Clone, Mouse, C-His tag MG52089-CH
    PTP4A2 cDNA ORF Clone, Mouse, N-His tag MG52089-NH
    PTP4A2 cDNA ORF Clone, Mouse, C-HA tag MG52089-CY
    PTP4A2 cDNA ORF Clone, Mouse, N-HA tag MG52089-NY
    PTP4A2 cDNA ORF Clone, Mouse, C-Myc tag MG52089-CM
    PTP4A2 qPCR Primer Pairs, Mouse MP201962

    PTP4A2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    PTP4A2 cDNA ORF Clone in Cloning Vector, Human HG13097-G
    PTP4A2 cDNA ORF Clone, Human, untagged HG13097-UT
    PTP4A2 cDNA ORF Clone, Human, C-GFPSpark® tag HG13097-ACG
    PTP4A2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13097-ACGLN
    PTP4A2 cDNA ORF Clone, Human, N-GFPSpark® tag HG13097-ANG
    PTP4A2 cDNA ORF Clone, Human, C-OFPSpark® tag HG13097-ACR
    PTP4A2 cDNA ORF Clone, Human, N-OFPSpark® tag HG13097-ANR
    PTP4A2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13097-CF
    PTP4A2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13097-NF
    PTP4A2 cDNA ORF Clone, Human, C-His tag HG13097-CH
    PTP4A2 cDNA ORF Clone, Human, N-His tag HG13097-NH
    PTP4A2 cDNA ORF Clone, Human, C-HA tag HG13097-CY
    PTP4A2 cDNA ORF Clone, Human, N-HA tag HG13097-NY
    PTP4A2 cDNA ORF Clone, Human, C-Myc tag HG13097-CM
    PTP4A2 cDNA ORF Clone, Human, N-Myc tag HG13097-NM
    PTP4A2 qPCR Primer Pairs, Human HP102573
    info info
    添加购物车成功! 添加购物车失败!