Quick Order

Mouse PRL-2/PTP4A2 Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Mouse PTP4A2 cDNA Clone Product Information
NCBI RefSeq:NM_001164745.1
RefSeq ORF Size:504bp
cDNA Description:Full length Clone DNA of Mus musculus protein tyrosine phosphatase 4a2 with N terminal His tag.
Gene Synonym:Prl-2
Species:Mouse
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

PRL-2 (Protein-tyrosine phosphatase of regenerating liver 2), also known as PTP4A2 (Protein tyrosine phosphatase type IVA, member 2), is a member of PTP family and has an important function in controlling cell growth. PRL-2 phosphatases may be multifunctional enzymes with diverse roles in a variety of tissue and cell types. The phosphatase of regenerating liver (PRL) family, comprising PRL-1, PRL-2 and PRL-3, is a group of prenylated phosphatases that are candidate cancer biomarkers and therapeutic targets. PRL-1, PRL-2, and PRL-3 represent a novel class of protein-tyrosine phosphatase with a C-terminal prenylation motif. They are three closely related intracellular enzymes that possess the PTP active site signature sequence CX 5R. The PRL-2 mRNA is elevated in primary breast tumors relative to matched normal tissue, and also dramatically elevated in metastatic lymph nodes compared with primary tumors. PRL-2 plays a role in breast cancer progression. PRL-2 is a pathogenic molecule in hematopoietic malignancies and suggest its potential as a novel therapeutic target.

References
  • Akiyama S, et al. (2010) PRL-2 increases Epo and IL-3 responses in hematopoietic cells. Blood Cells Mol Dis. 44(4): 209-14.
  • Hardy S, et al. (2010) Overexpression of the protein tyrosine phosphatase PRL-2 correlates with breast tumor formation and progression. Cancer Res. 70(21): 8959-67.
  • Yuan L, et al. (2007) Differential expression and functional constraint of PRL-2 in hibernating bat. Comp Biochem Physiol B Biochem Mol Biol. 148(4): 375-81.
  • Dumaual CM, et al. (2006) Cellular localization of PRL-1 and PRL-2 gene expression in normal adult human tissues. J Histochem Cytochem. 54(12): 1401-12.
  • Zeng Q, et al. (2000) Prenylation-dependent association of protein-tyrosine phosphatases PRL-1, -2, and -3 with the plasma membrane and the early endosome. J Biol Chem. 275(28): 21444-52.
  • Size / Price
    Catalog: MG52089-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"