Quick Order

Mouse PSPH Gene ORF cDNA clone expression plasmid, C-HA tag

DatasheetReviewsRelated ProductsProtocols
Mouse PSPH cDNA Clone Product Information
NCBI RefSeq:NM_133900.4
RefSeq ORF Size:678bp
cDNA Description:Full length Clone DNA of Mus musculus phosphoserine phosphatase with C terminal HA tag.
Gene Synonym:PSP; PSPase; AI480570
Species:Mouse
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Phosphoserine phosphatase (PSPH) belongs to a subfamily of the phosphotransferases. PSPH is the rate-limiting enzyme in l-serine biosynthesis. It has previously been found that Phosphoserine phosphatase (PSPH) plays a role in epidermal homeostasis. Phosphoserine phosphatase (PSP) catalyzes the hydrolysis of phosphoserine to serine. Phosphoserine phosphatase (PSPH) expression has been examined in human-mouse somatic cell hybrids retaining different combination of human chromosomes. Phosphoserine phosphatase (PSPH) is expressed throughout the proliferative layer of the epidermis and hair follicles in rodent and human skin and is highly induced in SCC. In keratinocytes, Phosphoserine phosphatase (PSPH) is a cytoplasmic protein that primarily localizes to endosomes and is present primarily as a homodimer. Knock down of Phosphoserine phosphatase (PSPH) dramatically diminished SCC cell proliferation and cyclin D1 levels in the presence of exogenous of l-serine production suggesting a non-canonical role for Phosphoserine phosphatase (PSPH) in epithelial carcinogenesis. Phosphoserine phosphatase (PSPH) is highly induced in proliferative normal keratinocytes and in skin tumors. Phosphoserine phosphatase (PSPH) appears to be critical for the proliferation of SCC cells; however, this phenomenon may not involve the phosphoserine metabolic pathway.

References
  • Bachelor MA, et al. (2011) L-3-Phosphoserine phosphatase (PSPH) regulates cutaneous squamous cell carcinoma proliferation independent of L-serine biosynthesis. J Dermatol Sci. 63(3): 164-72.
  • Koch GA, et al. (1983) Assignment of the human phosphoserine phosphatase gene (PSP) to the pter leads to q22 region of chromosome 7. Cytogenet Cell Genet. 35(1): 67-9.
  • Jaeken J, et al. (1997) Phosphoserine phosphatase deficiency in a patient with Williams syndrome. J Med Genet. 34(7): 594-6.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"