PSMD5 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag

Cat: MG51934-NF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All PSMD5 Reagents
CRO Services
Product recommended

All PSMD5 Reagents
PSMD5 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1515 bp
Description
Full length Clone DNA of Mouse proteasome (prosome, macropain) 26S subunit, non-ATPase, 5 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PSMD5 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag Alternative Names
1500032A03Rik cDNA ORF Clone, Mouse;AW475925 cDNA ORF Clone, Mouse;mKIAA0072 cDNA ORF Clone, Mouse;S5b cDNA ORF Clone, Mouse;W91691 cDNA ORF Clone, Mouse
PSMD5 Background Information
Full Name
proteasome 26S subunit, non-ATPase 5

PSMD5 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PSMD5 cDNA ORF Clone in Cloning Vector, Mouse MG51934-G
PSMD5 cDNA ORF Clone, Mouse, untagged MG51934-UT
PSMD5 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51934-ACG
PSMD5 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51934-ACGLN
PSMD5 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51934-ANG
PSMD5 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51934-ACR
PSMD5 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51934-ANR
PSMD5 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51934-CF
PSMD5 cDNA ORF Clone, Mouse, C-His tag MG51934-CH
PSMD5 cDNA ORF Clone, Mouse, N-His tag MG51934-NH
PSMD5 cDNA ORF Clone, Mouse, C-HA tag MG51934-CY
PSMD5 cDNA ORF Clone, Mouse, N-HA tag MG51934-NY
PSMD5 cDNA ORF Clone, Mouse, C-Myc tag MG51934-CM
PSMD5 cDNA ORF Clone, Mouse, N-Myc tag MG51934-NM
PSMD5 qPCR Primer Pairs, Mouse MP201807

PSMD5 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PSMD5 cDNA ORF Clone in Cloning Vector, Human HG19782-U
PSMD5 cDNA ORF Clone, Human, untagged HG19782-UT
PSMD5 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG19782-ACGLN
PSMD5 cDNA ORF Clone, Human, C-GFPSpark® tag HG19782-ACG
PSMD5 cDNA ORF Clone, Human, N-GFPSpark® tag HG19782-ANG
PSMD5 cDNA ORF Clone, Human, C-OFPSpark® tag HG19782-ACR
PSMD5 cDNA ORF Clone, Human, N-OFPSpark® tag HG19782-ANR
PSMD5 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG19782-CF
PSMD5 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG19782-NF
PSMD5 cDNA ORF Clone, Human, C-His tag HG19782-CH
PSMD5 cDNA ORF Clone, Human, N-His tag HG19782-NH
PSMD5 cDNA ORF Clone, Human, C-HA tag HG19782-CY
PSMD5 cDNA ORF Clone, Human, N-HA tag HG19782-NY
PSMD5 cDNA ORF Clone, Human, C-Myc tag HG19782-CM
PSMD5 cDNA ORF Clone, Human, N-Myc tag HG19782-NM
info info
添加购物车成功! 添加购物车失败!