PSMC1 cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG51540-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All PSMC1 Reagents
CRO Services
Product recommended

All PSMC1 Reagents
PSMC1 cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1323 bp
Description
Full length Clone DNA of Mouse protease (prosome, macropain) 26S subunit, ATPase 1 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PSMC1 cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
AI325227 cDNA ORF Clone, Mouse;P26s4 cDNA ORF Clone, Mouse;rpt2 cDNA ORF Clone, Mouse;Rpt2/S4 cDNA ORF Clone, Mouse;S4 cDNA ORF Clone, Mouse
PSMC1 Background Information
Full Name
proteasome (prosome, macropain) 26S subunit, ATPase, 1

PSMC1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
PSMC1 cDNA ORF Clone in Cloning Vector, Rat RG86111-U
PSMC1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG86111-ACGLN

PSMC1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PSMC1 cDNA ORF Clone in Cloning Vector, Mouse MG51540-U
PSMC1 cDNA ORF Clone, Mouse, untagged MG51540-UT
PSMC1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51540-ACGLN
PSMC1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51540-ACG
PSMC1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51540-ANG
PSMC1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51540-ACR
PSMC1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51540-ANR
PSMC1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51540-CF
PSMC1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51540-NF
PSMC1 cDNA ORF Clone, Mouse, C-His tag MG51540-CH
PSMC1 cDNA ORF Clone, Mouse, N-His tag MG51540-NH
PSMC1 cDNA ORF Clone, Mouse, C-HA tag MG51540-CY
PSMC1 cDNA ORF Clone, Mouse, N-HA tag MG51540-NY
PSMC1 cDNA ORF Clone, Mouse, C-Myc tag MG51540-CM
PSMC1 qPCR Primer Pairs, Mouse MP201424

PSMC1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PSMC1 cDNA ORF Clone in Cloning Vector, Human HG18951-U
PSMC1 cDNA ORF Clone, Human, untagged HG18951-UT
PSMC1 cDNA ORF Clone, Human, C-GFPSpark® tag HG18951-ACG
PSMC1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG18951-ACGLN
PSMC1 cDNA ORF Clone, Human, N-GFPSpark® tag HG18951-ANG
PSMC1 cDNA ORF Clone, Human, C-OFPSpark® tag HG18951-ACR
PSMC1 cDNA ORF Clone, Human, N-OFPSpark® tag HG18951-ANR
PSMC1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG18951-CF
PSMC1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG18951-NF
PSMC1 cDNA ORF Clone, Human, C-His tag HG18951-CH
PSMC1 cDNA ORF Clone, Human, N-His tag HG18951-NH
PSMC1 cDNA ORF Clone, Human, C-HA tag HG18951-CY
PSMC1 cDNA ORF Clone, Human, N-HA tag HG18951-NY
PSMC1 cDNA ORF Clone, Human, C-Myc tag HG18951-CM
PSMC1 cDNA ORF Clone, Human, N-Myc tag HG18951-NM
info info
添加购物车成功! 添加购物车失败!