PSMB7 cDNA ORF Clone, Mouse, C-His tag

Cat: MG51265-CH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All PSMB7 Reagents
CRO Services
Product recommended

All PSMB7 Reagents
PSMB7 cDNA ORF Clone, Mouse, C-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
834 bp
Description
Full length Clone DNA of Mouse proteasome (prosome, macropain) subunit, beta type 7 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PSMB7 cDNA ORF Clone, Mouse, C-His tag Alternative Names
AU020723 cDNA ORF Clone, Mouse;MC14 cDNA ORF Clone, Mouse
PSMB7 Background Information
Full Name
proteasome (prosome, macropain) subunit, beta type, 7

PSMB7 cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
PSMB7 cDNA ORF Clone in Cloning Vector, Canine DG70124-U

PSMB7 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
PSMB7 cDNA ORF Clone in Cloning Vector, Rat RG86920-U
PSMB7 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG86920-ACGLN

PSMB7 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PSMB7 cDNA ORF Clone in Cloning Vector, Mouse MG51265-U
PSMB7 cDNA ORF Clone, Mouse, untagged MG51265-UT
PSMB7 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51265-ACGLN
PSMB7 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51265-ACG
PSMB7 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51265-ANG
PSMB7 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51265-ACR
PSMB7 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51265-ANR
PSMB7 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51265-CF
PSMB7 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51265-NF
PSMB7 cDNA ORF Clone, Mouse, N-His tag MG51265-NH
PSMB7 cDNA ORF Clone, Mouse, C-HA tag MG51265-CY
PSMB7 cDNA ORF Clone, Mouse, N-HA tag MG51265-NY
PSMB7 cDNA ORF Clone, Mouse, C-Myc tag MG51265-CM
PSMB7 cDNA ORF Clone, Mouse, N-Myc tag MG51265-NM
PSMB7 qPCR Primer Pairs, Mouse MP201147

PSMB7 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PSMB7 cDNA ORF Clone in Cloning Vector, Human HG16159-G
PSMB7 cDNA ORF Clone, Human, untagged HG16159-UT
PSMB7 cDNA ORF Clone, Human, C-GFPSpark® tag HG16159-ACG
PSMB7 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16159-ACGLN
PSMB7 cDNA ORF Clone, Human, N-GFPSpark® tag HG16159-ANG
PSMB7 cDNA ORF Clone, Human, C-OFPSpark® tag HG16159-ACR
PSMB7 cDNA ORF Clone, Human, N-OFPSpark® tag HG16159-ANR
PSMB7 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16159-CF
PSMB7 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16159-NF
PSMB7 cDNA ORF Clone, Human, C-His tag HG16159-CH
PSMB7 cDNA ORF Clone, Human, N-His tag HG16159-NH
PSMB7 cDNA ORF Clone, Human, C-HA tag HG16159-CY
PSMB7 cDNA ORF Clone, Human, N-HA tag HG16159-NY
PSMB7 cDNA ORF Clone, Human, C-Myc tag HG16159-CM
PSMB7 cDNA ORF Clone, Human, N-Myc tag HG16159-NM
PSMB7 qPCR Primer Pairs, Human HP104928
info info
添加购物车成功! 添加购物车失败!