PSMA6 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG51652-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PSMA6 Reagents
CRO Services
Product recommended

All PSMA6 Reagents
PSMA6 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
741 bp
Description
Full length Clone DNA of Mouse proteasome (prosome, macropain) subunit, alpha type 6 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PSMA6 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
IOTA cDNA ORF Clone, Mouse
PSMA6 Background Information
Full Name
proteasome (prosome, macropain) subunit, alpha type, 6

PSMA6 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PSMA6 cDNA ORF Clone in Cloning Vector, Mouse MG51652-G
PSMA6 cDNA ORF Clone, Mouse, untagged MG51652-UT
PSMA6 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51652-ACGLN
PSMA6 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51652-ACG
PSMA6 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51652-ANG
PSMA6 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51652-ACR
PSMA6 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51652-ANR
PSMA6 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51652-NF
PSMA6 cDNA ORF Clone, Mouse, C-His tag MG51652-CH
PSMA6 cDNA ORF Clone, Mouse, N-His tag MG51652-NH
PSMA6 cDNA ORF Clone, Mouse, C-HA tag MG51652-CY
PSMA6 cDNA ORF Clone, Mouse, N-HA tag MG51652-NY
PSMA6 cDNA ORF Clone, Mouse, C-Myc tag MG51652-CM
PSMA6 cDNA ORF Clone, Mouse, N-Myc tag MG51652-NM
PSMA6 qPCR Primer Pairs, Mouse MP201525

PSMA6 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PSMA6 cDNA ORF Clone in Cloning Vector, Human HG14647-G
PSMA6 cDNA ORF Clone, Human, untagged HG14647-UT
PSMA6 cDNA ORF Clone, Human, C-GFPSpark® tag HG14647-ACG
PSMA6 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14647-ACGLN
PSMA6 cDNA ORF Clone, Human, N-GFPSpark® tag HG14647-ANG
PSMA6 cDNA ORF Clone, Human, C-OFPSpark® tag HG14647-ACR
PSMA6 cDNA ORF Clone, Human, N-OFPSpark® tag HG14647-ANR
PSMA6 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14647-CF
PSMA6 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14647-NF
PSMA6 cDNA ORF Clone, Human, C-His tag HG14647-CH
PSMA6 cDNA ORF Clone, Human, N-His tag HG14647-NH
PSMA6 cDNA ORF Clone, Human, C-HA tag HG14647-CY
PSMA6 cDNA ORF Clone, Human, N-HA tag HG14647-NY
PSMA6 cDNA ORF Clone, Human, C-Myc tag HG14647-CM
PSMA6 cDNA ORF Clone, Human, N-Myc tag HG14647-NM
PSMA6 qPCR Primer Pairs, Human HP103281
info info
添加购物车成功! 添加购物车失败!