PRUNE cDNA ORF Clone, Mouse, N-HA tag

Cat: MG52881-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PRUNE Reagents
CRO Services
Product recommended

All PRUNE Reagents
PRUNE cDNA ORF Clone, Mouse, N-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1365 bp
Description
Full length Clone DNA of Mouse prune homolog (Drosophila) with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PRUNE cDNA ORF Clone, Mouse, N-HA tag Alternative Names
9230112O05Rik cDNA ORF Clone, Mouse;C130058A12 cDNA ORF Clone, Mouse;DRES-17 cDNA ORF Clone, Mouse;HTCD37 cDNA ORF Clone, Mouse;Prune-M1 cDNA ORF Clone, Mouse;PRUNEM1 cDNA ORF Clone, Mouse
PRUNE Background Information
Full Name
prune exopolyphosphatase

PRUNE cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PRUNE cDNA ORF Clone in Cloning Vector, Mouse MG52881-G
PRUNE cDNA ORF Clone, Mouse, untagged MG52881-UT
PRUNE Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52881-ACGLN
PRUNE cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52881-ACG
PRUNE cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52881-ANG
PRUNE cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52881-ACR
PRUNE cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52881-ANR
PRUNE cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52881-CF
PRUNE cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52881-NF
PRUNE cDNA ORF Clone, Mouse, C-His tag MG52881-CH
PRUNE cDNA ORF Clone, Mouse, N-His tag MG52881-NH
PRUNE cDNA ORF Clone, Mouse, C-HA tag MG52881-CY
PRUNE cDNA ORF Clone, Mouse, C-Myc tag MG52881-CM
PRUNE cDNA ORF Clone, Mouse, N-Myc tag MG52881-NM

PRUNE cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PRUNE cDNA ORF Clone in Cloning Vector, Human HG16167-G
PRUNE cDNA ORF Clone, Human, untagged HG16167-UT
PRUNE Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16167-ACGLN
PRUNE cDNA ORF Clone, Human, C-GFPSpark® tag HG16167-ACG
PRUNE cDNA ORF Clone, Human, N-GFPSpark® tag HG16167-ANG
PRUNE cDNA ORF Clone, Human, C-OFPSpark® tag HG16167-ACR
PRUNE cDNA ORF Clone, Human, N-OFPSpark® tag HG16167-ANR
PRUNE cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16167-CF
PRUNE cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16167-NF
PRUNE cDNA ORF Clone, Human, C-His tag HG16167-CH
PRUNE cDNA ORF Clone, Human, N-His tag HG16167-NH
PRUNE cDNA ORF Clone, Human, C-HA tag HG16167-CY
PRUNE cDNA ORF Clone, Human, N-HA tag HG16167-NY
PRUNE cDNA ORF Clone, Human, C-Myc tag HG16167-CM
PRUNE cDNA ORF Clone, Human, N-Myc tag HG16167-NM
PRUNE qPCR Primer Pairs, Human HP104936
info info
添加购物车成功! 添加购物车失败!