After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse Trypsin-3/PRSS3 Gene ORF cDNA clone expression plasmid, N-Flag tag

DatasheetReviewsRelated ProductsProtocols
Mouse PRSS3 cDNA Clone Product Information
NCBI RefSeq:NM_011645.2
RefSeq ORF Size:741bp
cDNA Description:Full length Clone DNA of Mus musculus protease, serine, 3 with N terminal Flag tag.
Gene Synonym:Tb, MTG, TRY4, Try3
Species:Mouse
Vector:pCMV3-SP-N-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

Trypsin-3, also known as Trypsin III, brain trypsinogen, Serine protease 3 and PRSS3, is a secreted protein which belongs to the peptidase S1 family. Trypsin-3 / PRSS3 is expressed is in pancreas and brain. It contains one peptidase S1 domain. Trypsin-3 / PRSS3 can degrade intrapancreatic trypsin inhibitors that protect against CP. Genetic variants that cause higher mesotrypsin activity might increase the risk for chronic pancreatitis (CP). A sustained imbalance of pancreatic proteases and their inhibitors seems to be important for the development of CP. The trypsin inhibitor-degrading activity qualified PRSS3 as a candidate for a novel CP susceptibility gene. Trypsin-3 / PRSS3 has been implicated as a putative tumor suppressor gene due to its loss of expression, which is correlated with promoter hypermethylation, in esophageal squamous cell carcinoma and gastric adenocarcinoma.

References
  • Venter JC. et al., 2001, Science 291:1304-51.
  • Marsit,CJ. et al., 2005, Mol Carcinog 44 (2):146-50.
  • Rowen, L. et al., 2005, Mol Biol Evol. 22 (8):1712-20.
  • Rosendahl, J. et al., 2010, Pancreatology. 10 (2-3):243-9
  • Size / Price
    Catalog: MG50499-NF
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"