PRPS1 cDNA ORF Clone, Mouse, C-HA tag

Cat: MG51324-CY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All PRPS1 Reagents
CRO Services
Product recommended

All PRPS1 Reagents
PRPS1 cDNA ORF Clone, Mouse, C-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
957 bp
Description
Full length Clone DNA of Mouse phosphoribosyl pyrophosphate synthetase 1 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PRPS1 cDNA ORF Clone, Mouse, C-HA tag Alternative Names
2310010D17Rik cDNA ORF Clone, Mouse;C76571 cDNA ORF Clone, Mouse;C76678 cDNA ORF Clone, Mouse;Prps-1 cDNA ORF Clone, Mouse;PRS-I cDNA ORF Clone, Mouse
PRPS1 Background Information
Full Name
phosphoribosyl pyrophosphate synthetase 1

PRPS1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
PRPS1 cDNA ORF Clone in Cloning Vector, Rat RG83452-U
PRPS1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG83452-ACGLN

PRPS1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PRPS1 cDNA ORF Clone in Cloning Vector, Mouse MG5A7580-U
PRPS1 cDNA ORF Clone in Cloning Vector, Mouse MG51324-U
PRPS1 cDNA ORF Clone, Mouse, untagged MG51324-UT
PRPS1 cDNA ORF Clone, Mouse, untagged MG5A7580-UT
PRPS1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51324-ACG
PRPS1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51324-ACGLN
PRPS1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A7580-ACG
PRPS1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A7580-ACGLN
PRPS1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A7580-ANG
PRPS1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51324-ANG
PRPS1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A7580-ACR
PRPS1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51324-ACR
PRPS1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A7580-ANR
PRPS1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51324-ANR
PRPS1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51324-CF
PRPS1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A7580-CF
PRPS1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51324-NF
PRPS1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A7580-NF
PRPS1 cDNA ORF Clone, Mouse, C-His tag MG5A7580-CH
PRPS1 cDNA ORF Clone, Mouse, C-His tag MG51324-CH
PRPS1 cDNA ORF Clone, Mouse, N-His tag MG51324-NH
PRPS1 cDNA ORF Clone, Mouse, N-His tag MG5A7580-NH
PRPS1 cDNA ORF Clone, Mouse, C-HA tag MG5A7580-CY
PRPS1 cDNA ORF Clone, Mouse, N-HA tag MG51324-NY
PRPS1 cDNA ORF Clone, Mouse, N-HA tag MG5A7580-NY
PRPS1 cDNA ORF Clone, Mouse, C-Myc tag MG5A7580-CM
PRPS1 cDNA ORF Clone, Mouse, C-Myc tag MG51324-CM
PRPS1 cDNA ORF Clone, Mouse, N-Myc tag MG51324-NM
PRPS1 cDNA ORF Clone, Mouse, N-Myc tag MG5A7580-NM
PRPS1 qPCR Primer Pairs, Mouse MP201201

PRPS1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PRPS1 cDNA ORF Clone in Cloning Vector, Human HG17214-U
PRPS1 cDNA ORF Clone, Human, untagged HG17214-UT
PRPS1 cDNA ORF Clone, Human, C-GFPSpark® tag HG17214-ACG
PRPS1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG17214-ACGLN
PRPS1 cDNA ORF Clone, Human, N-GFPSpark® tag HG17214-ANG
PRPS1 cDNA ORF Clone, Human, C-OFPSpark® tag HG17214-ACR
PRPS1 cDNA ORF Clone, Human, N-OFPSpark® tag HG17214-ANR
PRPS1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG17214-CF
PRPS1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG17214-NF
PRPS1 cDNA ORF Clone, Human, C-His tag HG17214-CH
PRPS1 cDNA ORF Clone, Human, N-His tag HG17214-NH
PRPS1 cDNA ORF Clone, Human, C-HA tag HG17214-CY
PRPS1 cDNA ORF Clone, Human, N-HA tag HG17214-NY
PRPS1 cDNA ORF Clone, Human, C-Myc tag HG17214-CM
PRPS1 cDNA ORF Clone, Human, N-Myc tag HG17214-NM
info info
添加购物车成功! 添加购物车失败!