PROSC cDNA ORF Clone, Mouse, N-His tag

Cat: MG52855-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All PROSC Reagents
CRO Services
Product recommended

All PROSC Reagents
PROSC cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
825 bp
Description
Full length Clone DNA of Mouse proline synthetase co-transcribed with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PROSC cDNA ORF Clone, Mouse, N-His tag Alternative Names
1700024N20Rik cDNA ORF Clone, Mouse;2200002F22Rik cDNA ORF Clone, Mouse
PROSC Background Information
Full Name
proline synthetase co-transcribed homolog (bacterial)

PROSC cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
PROSC cDNA ORF Clone in Cloning Vector, Rat RG80860-U
PROSC cDNA ORF Clone, Rat, untagged RG80860-UT
PROSC Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80860-ACGLN
PROSC cDNA ORF Clone, Rat, C-GFPSpark® tag RG80860-ACG
PROSC cDNA ORF Clone, Rat, N-GFPSpark® tag RG80860-ANG
PROSC cDNA ORF Clone, Rat, C-OFPSpark® tag RG80860-ACR
PROSC cDNA ORF Clone, Rat, N-OFPSpark® tag RG80860-ANR
PROSC cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80860-CF
PROSC cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80860-NF
PROSC cDNA ORF Clone, Rat, C-His tag RG80860-CH
PROSC cDNA ORF Clone, Rat, N-His tag RG80860-NH
PROSC cDNA ORF Clone, Rat, C-HA tag RG80860-CY
PROSC cDNA ORF Clone, Rat, N-HA tag RG80860-NY
PROSC cDNA ORF Clone, Rat, C-Myc tag RG80860-CM
PROSC cDNA ORF Clone, Rat, N-Myc tag RG80860-NM
PROSC qPCR Primer Pairs, Rat RP300824

PROSC cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PROSC cDNA ORF Clone in Cloning Vector, Mouse MG52855-G
PROSC cDNA ORF Clone, Mouse, untagged MG52855-UT
PROSC cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52855-ACG
PROSC Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52855-ACGLN
PROSC cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52855-ANG
PROSC cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52855-ACR
PROSC cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52855-ANR
PROSC cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52855-CF
PROSC cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52855-NF
PROSC cDNA ORF Clone, Mouse, C-His tag MG52855-CH
PROSC cDNA ORF Clone, Mouse, C-HA tag MG52855-CY
PROSC cDNA ORF Clone, Mouse, N-HA tag MG52855-NY
PROSC cDNA ORF Clone, Mouse, C-Myc tag MG52855-CM
PROSC cDNA ORF Clone, Mouse, N-Myc tag MG52855-NM

PROSC cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PROSC cDNA ORF Clone in Cloning Vector, Human HG25082-U
PROSC Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG25082-ACGLN
info info
添加购物车成功! 添加购物车失败!