PRKCB cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG51036-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PRKCB Reagents
CRO Services
Product recommended

All PRKCB Reagents
PRKCB cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2022 bp
Description
Full length Clone DNA of Mouse protein kinase C, beta with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PRKCB cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
A130082F03Rik cDNA ORF Clone, Mouse;PKC-Beta cDNA ORF Clone, Mouse;Pkcb cDNA ORF Clone, Mouse;Prkcb1 cDNA ORF Clone, Mouse;Prkcb2 cDNA ORF Clone, Mouse
PRKCB Background Information
Full Name
protein kinase C, beta

PRKCB cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PRKCB cDNA ORF Clone in Cloning Vector, Mouse MG51036-G
PRKCB cDNA ORF Clone, Mouse, untagged MG51036-UT
PRKCB Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51036-ACGLN
PRKCB cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51036-ACG
PRKCB cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51036-ANG
PRKCB cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51036-ACR
PRKCB cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51036-ANR
PRKCB cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51036-NF
PRKCB cDNA ORF Clone, Mouse, C-His tag MG51036-CH
PRKCB cDNA ORF Clone, Mouse, N-His tag MG51036-NH
PRKCB cDNA ORF Clone, Mouse, C-HA tag MG51036-CY
PRKCB cDNA ORF Clone, Mouse, N-HA tag MG51036-NY
PRKCB cDNA ORF Clone, Mouse, C-Myc tag MG51036-CM
PRKCB cDNA ORF Clone, Mouse, N-Myc tag MG51036-NM
PRKCB qPCR Primer Pairs, Mouse MP200995

PRKCB cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PRKCB cDNA ORF Clone in Cloning Vector, Human HG10750-U
PRKCB cDNA ORF Clone, Human, untagged HG10750-UT
PRKCB cDNA ORF Clone, Human, C-GFPSpark® tag HG10750-ACG
PRKCB Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10750-ACGLN
PRKCB cDNA ORF Clone, Human, N-GFPSpark® tag HG10750-ANG
PRKCB cDNA ORF Clone, Human, C-OFPSpark® tag HG10750-ACR
PRKCB cDNA ORF Clone, Human, N-OFPSpark® tag HG10750-ANR
PRKCB cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10750-U-F
PRKCB cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10750-CF
PRKCB cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10750-NF
PRKCB cDNA ORF Clone, Human, C-His tag HG10750-CH
PRKCB cDNA ORF Clone, Human, N-His tag HG10750-NH
PRKCB cDNA ORF Clone, Human, C-HA tag HG10750-CY
PRKCB cDNA ORF Clone, Human, N-HA tag HG10750-NY
PRKCB cDNA ORF Clone, Human, C-Myc tag HG10750-CM
PRKCB cDNA ORF Clone, Human, N-Myc tag HG10750-NM
PRKCB qPCR Primer Pairs, Human HP100683
info info
添加购物车成功! 添加购物车失败!