Quick Order

Mouse PRKAR1A / PRKAR1 / PKR1 Gene ORF cDNA clone expression plasmid, C-Myc tag

DatasheetReviewsRelated ProductsProtocols
Mouse PRKAR1A cDNA Clone Product Information
NCBI RefSeq:NM_021880.2
RefSeq ORF Size:1146bp
cDNA Description:Full length Clone DNA of Mus musculus protein kinase, cAMP dependent regulatory, type I, alpha with C terminal Myc tag.
Gene Synonym:Tse1, Tse-1, RIalpha, 1300018C22Rik
Species:Mouse
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

PRKAR1A, also known as PRKAR1 and PKR1, is one of the regulatory subunits of cAMP-dependent protein kinase A (PKA). PKA can be activated by cAMP. cAMP is a signaling molecule important for a variety of cellular functions. cAMP exerts its effects by activating PKA, which transduces the signal throughphosphorylation of different target proteins. The inactive holoenzyme of PKA is a tetramer composed of two regulatory and two catalytic subunits. cAMP causes the dissociation of the inactive holoenzyme into a dimer of regulatory subunits bound to four cAMP and two free monomeric catalytic subunits. Four different regulatory subunits and three catalytic subunits of PKA have been identified in humans. PRKAR1A was found to be a tissue-specific extinguisher that down-regulates the expression of seven liver genes in hepatoma x fibroblast hybrids Three alternatively spliced transcript variants encoding the same protein have been observed.

References
  • Huang L J. et al., 1997, Proc Natl Acad Sci. 94 (21): 11184-9.
  • Herberg F W. et al., 2000, J Mol Biol. 298 (2): 329-39.
  • Scambler P. et al., 1987, Am J Hum Genet. 41 (5): 925-32.
  • Size / Price
    Catalog: MG51743-CM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"