Quick Order

Mouse PRKAR1A ORF mammalian expression plasmid, C-Flag tag

DatasheetReviewsRelated ProductsProtocols
Mouse PRKAR1A cDNA Clone Product Information
NCBI RefSeq:NM_021880.2
RefSeq ORF Size:1146bp
cDNA Description:Full length Clone DNA of Mus musculus protein kinase, cAMP dependent regulatory, type I, alpha with C terminal Flag tag.
Gene Synonym:Tse1, Tse-1, RIalpha, 1300018C22Rik
Species:Mouse
Vector:pCMV3-C-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

PRKAR1A, also known as PRKAR1 and PKR1, is one of the regulatory subunits of cAMP-dependent protein kinase A (PKA). PKA can be activated by cAMP. cAMP is a signaling molecule important for a variety of cellular functions. cAMP exerts its effects by activating PKA, which transduces the signal throughphosphorylation of different target proteins. The inactive holoenzyme of PKA is a tetramer composed of two regulatory and two catalytic subunits. cAMP causes the dissociation of the inactive holoenzyme into a dimer of regulatory subunits bound to four cAMP and two free monomeric catalytic subunits. Four different regulatory subunits and three catalytic subunits of PKA have been identified in humans. PRKAR1A was found to be a tissue-specific extinguisher that down-regulates the expression of seven liver genes in hepatoma x fibroblast hybrids Three alternatively spliced transcript variants encoding the same protein have been observed.

References
  • Huang L J. et al., 1997, Proc Natl Acad Sci. 94 (21): 11184-9.
  • Herberg F W. et al., 2000, J Mol Biol. 298 (2): 329-39.
  • Scambler P. et al., 1987, Am J Hum Genet. 41 (5): 925-32.
  • Size / Price
    Catalog: MG51743-CF
    List Price:   (Save )
    Price:      [How to order]
    Availability
     Shipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"