PRKACA cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG50618-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PRKACA Reagents
CRO Services
Product recommended

All PRKACA Reagents
PRKACA cDNA ORF Clone, Mouse, C-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1056 bp
Description
Full length Clone DNA of Mouse protein kinase, cAMP dependent, catalytic, alpha with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PRKACA cDNA ORF Clone, Mouse, C-Myc tag Alternative Names
Pkaca cDNA ORF Clone, Mouse;PKCD cDNA ORF Clone, Mouse
PRKACA Background Information
Full Name
protein kinase, cAMP-dependent, alpha catalytic subunit

PRKACA cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PRKACA cDNA ORF Clone in Cloning Vector, Mouse MG50618-M
PRKACA cDNA ORF Clone, Mouse, untagged MG50618-UT
PRKACA Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50618-ACGLN
PRKACA cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50618-ACG
PRKACA cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50618-ANG
PRKACA cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50618-ACR
PRKACA cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50618-ANR
PRKACA cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50618-CF
PRKACA cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50618-NF
PRKACA cDNA ORF Clone, Mouse, C-His tag MG50618-CH
PRKACA cDNA ORF Clone, Mouse, N-His tag MG50618-NH
PRKACA cDNA ORF Clone, Mouse, C-HA tag MG50618-CY
PRKACA cDNA ORF Clone, Mouse, N-HA tag MG50618-NY
PRKACA cDNA ORF Clone, Mouse, N-Myc tag MG50618-NM
PRKACA qPCR Primer Pairs, Mouse MP200603

PRKACA cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PRKACA cDNA ORF Clone in Cloning Vector, Human HG11544-M
PRKACA cDNA ORF Clone, Human, untagged HG11544-UT
PRKACA Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11544-ACGLN
PRKACA cDNA ORF Clone, Human, C-GFPSpark® tag HG11544-ACG
PRKACA cDNA ORF Clone, Human, N-GFPSpark® tag HG11544-ANG
PRKACA cDNA ORF Clone, Human, C-OFPSpark® tag HG11544-ACR
PRKACA cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11544-CF
PRKACA cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11544-NF
PRKACA cDNA ORF Clone, Human, C-His tag HG11544-CH
PRKACA cDNA ORF Clone, Human, N-His tag HG11544-NH
PRKACA cDNA ORF Clone, Human, C-HA tag HG11544-CY
PRKACA cDNA ORF Clone, Human, N-HA tag HG11544-NY
PRKACA cDNA ORF Clone, Human, C-Myc tag HG11544-CM
PRKACA cDNA ORF Clone, Human, N-Myc tag HG11544-NM
PRKACA qPCR Primer Pairs, Human HP101412
info info
添加购物车成功! 添加购物车失败!