Quick Order

Mouse PRDX6 ORF mammalian expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Mouse PRDX6 cDNA Clone Product Information
NCBI RefSeq:NM_007453
RefSeq ORF Size:675bp
cDNA Description:Full length Clone DNA of Mus musculus peroxiredoxin 6 with N terminal His tag.
Gene Synonym:GPx; Aop2; CP-3; Ltw4; Ltw-4; NSGPx; ORF06; Prdx5; Brp-12; Lvtw-4; aiPLA2; 1-cysPrx; AA690119; 1-Cys Prx; 9430088D19Rik
Species:Mouse
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Size / Price
Catalog: MG51391-NH
List Price:   (Save )
Price:      [How to order]
Availability
 Shipping instructions
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"