PPP2CA cDNA ORF Clone, Mouse, untagged

Cat: MG51667-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All PPP2CA Reagents
CRO Services
Product recommended

All PPP2CA Reagents
PPP2CA cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
930 bp
Description
Full length Clone DNA of Mouse protein phosphatase 2 (formerly 2A), catalytic subunit, alpha isoform.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PPP2CA cDNA ORF Clone, Mouse, untagged Alternative Names
PP2A cDNA ORF Clone, Mouse;R75353 cDNA ORF Clone, Mouse
PPP2CA Background Information
Full Name
protein phosphatase 2, catalytic subunit, alpha isozyme

PPP2CA cDNA ORF Clone, Rabbit, Related Products

Product Name Catalog#(PDF)
PPP2CA cDNA ORF Clone in Cloning Vector, Rabbit TG65122-G
PPP2CA cDNA ORF Clone, Rabbit, untagged TG65122-UT
PPP2CA cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65122-ACG
PPP2CA Lentiviral cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65122-ACGLN
PPP2CA cDNA ORF Clone, Rabbit, N-GFPSpark® tag TG65122-ANG
PPP2CA cDNA ORF Clone, Rabbit, C-OFPSpark® tag TG65122-ACR
PPP2CA cDNA ORF Clone, Rabbit, N-OFPSpark® tag TG65122-ANR
PPP2CA cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag TG65122-CF
PPP2CA cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag TG65122-NF
PPP2CA cDNA ORF Clone, Rabbit, C-His tag TG65122-CH
PPP2CA cDNA ORF Clone, Rabbit, N-His tag TG65122-NH
PPP2CA cDNA ORF Clone, Rabbit, C-HA tag TG65122-CY
PPP2CA cDNA ORF Clone, Rabbit, N-HA tag TG65122-NY
PPP2CA cDNA ORF Clone, Rabbit, C-Myc tag TG65122-CM
PPP2CA cDNA ORF Clone, Rabbit, N-Myc tag TG65122-NM

PPP2CA cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PPP2CA cDNA ORF Clone in Cloning Vector, Mouse MG51667-G
PPP2CA cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51667-ACG
PPP2CA Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51667-ACGLN
PPP2CA cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51667-ANG
PPP2CA cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51667-ACR
PPP2CA cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51667-ANR
PPP2CA cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51667-CF
PPP2CA cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51667-NF
PPP2CA cDNA ORF Clone, Mouse, C-His tag MG51667-CH
PPP2CA cDNA ORF Clone, Mouse, N-His tag MG51667-NH
PPP2CA cDNA ORF Clone, Mouse, C-HA tag MG51667-CY
PPP2CA cDNA ORF Clone, Mouse, N-HA tag MG51667-NY
PPP2CA cDNA ORF Clone, Mouse, C-Myc tag MG51667-CM
PPP2CA cDNA ORF Clone, Mouse, N-Myc tag MG51667-NM
PPP2CA qPCR Primer Pairs, Mouse MP201540

PPP2CA cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PPP2CA cDNA ORF Clone in Cloning Vector, Human HG10420-M
PPP2CA cDNA ORF Clone, Human, untagged HG10420-UT
PPP2CA cDNA ORF Clone, Human, C-GFPSpark® tag HG10420-ACG
PPP2CA Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10420-ACGLN
PPP2CA cDNA ORF Clone, Human, N-GFPSpark® tag HG10420-ANG
PPP2CA cDNA ORF Clone, Human, C-OFPSpark® tag HG10420-ACR
PPP2CA cDNA ORF Clone, Human, N-OFPSpark® tag HG10420-ANR
PPP2CA cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10420-CF
PPP2CA cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10420-NF
PPP2CA cDNA ORF Clone, Human, C-His tag HG10420-CH
PPP2CA cDNA ORF Clone, Human, N-His tag HG10420-NH
PPP2CA cDNA ORF Clone, Human, C-HA tag HG10420-CY
PPP2CA cDNA ORF Clone, Human, N-HA tag HG10420-NY
PPP2CA cDNA ORF Clone, Human, C-Myc tag HG10420-CM
PPP2CA cDNA ORF Clone, Human, N-Myc tag HG10420-NM
PPP2CA qPCR Primer Pairs, Human HP100450
info info
添加购物车成功! 添加购物车失败!