PPP1R2 cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG52063-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PPP1R2 Reagents
CRO Services
Product recommended

All PPP1R2 Reagents
PPP1R2 cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
621 bp
Description
Full length Clone DNA of Mouse protein phosphatase 1, regulatory (inhibitor) subunit 2 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PPP1R2 cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
0610025N14Rik cDNA ORF Clone, Mouse;2310007G06Rik cDNA ORF Clone, Mouse;4930440J04Rik cDNA ORF Clone, Mouse;5430408E15Rik cDNA ORF Clone, Mouse;D16Ertd248e cDNA ORF Clone, Mouse;IPP-2 cDNA ORF Clone, Mouse
PPP1R2 Background Information
Full Name
protein phosphatase 1, regulatory (inhibitor) subunit 2

PPP1R2 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
PPP1R2 cDNA ORF Clone in Cloning Vector, Rhesus CG90688-G
PPP1R2 cDNA ORF Clone, Rhesus, untagged CG90688-UT
PPP1R2 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90688-ACGLN
PPP1R2 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90688-ACG
PPP1R2 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90688-ANG
PPP1R2 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90688-ACR
PPP1R2 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90688-ANR
PPP1R2 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90688-CF
PPP1R2 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90688-NF
PPP1R2 cDNA ORF Clone, Rhesus, C-His tag CG90688-CH
PPP1R2 cDNA ORF Clone, Rhesus, N-His tag CG90688-NH
PPP1R2 cDNA ORF Clone, Rhesus, C-HA tag CG90688-CY
PPP1R2 cDNA ORF Clone, Rhesus, N-HA tag CG90688-NY
PPP1R2 cDNA ORF Clone, Rhesus, C-Myc tag CG90688-CM
PPP1R2 cDNA ORF Clone, Rhesus, N-Myc tag CG90688-NM

PPP1R2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PPP1R2 cDNA ORF Clone in Cloning Vector, Mouse MG52063-U
PPP1R2 cDNA ORF Clone, Mouse, untagged MG52063-UT
PPP1R2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52063-ACGLN
PPP1R2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52063-ACG
PPP1R2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52063-ANG
PPP1R2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52063-ACR
PPP1R2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52063-ANR
PPP1R2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52063-CF
PPP1R2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52063-NF
PPP1R2 cDNA ORF Clone, Mouse, C-His tag MG52063-CH
PPP1R2 cDNA ORF Clone, Mouse, N-His tag MG52063-NH
PPP1R2 cDNA ORF Clone, Mouse, C-HA tag MG52063-CY
PPP1R2 cDNA ORF Clone, Mouse, N-HA tag MG52063-NY
PPP1R2 cDNA ORF Clone, Mouse, C-Myc tag MG52063-CM
PPP1R2 qPCR Primer Pairs, Mouse MP201936

PPP1R2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PPP1R2 cDNA ORF Clone in Cloning Vector, Human HG16293-G
PPP1R2 cDNA ORF Clone, Human, untagged HG16293-UT
PPP1R2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16293-ACGLN
PPP1R2 cDNA ORF Clone, Human, C-GFPSpark® tag HG16293-ACG
PPP1R2 cDNA ORF Clone, Human, N-GFPSpark® tag HG16293-ANG
PPP1R2 cDNA ORF Clone, Human, C-OFPSpark® tag HG16293-ACR
PPP1R2 cDNA ORF Clone, Human, N-OFPSpark® tag HG16293-ANR
PPP1R2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16293-CF
PPP1R2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16293-NF
PPP1R2 cDNA ORF Clone, Human, C-His tag HG16293-CH
PPP1R2 cDNA ORF Clone, Human, N-His tag HG16293-NH
PPP1R2 cDNA ORF Clone, Human, C-HA tag HG16293-CY
PPP1R2 cDNA ORF Clone, Human, N-HA tag HG16293-NY
PPP1R2 cDNA ORF Clone, Human, C-Myc tag HG16293-CM
PPP1R2 cDNA ORF Clone, Human, N-Myc tag HG16293-NM
PPP1R2 qPCR Primer Pairs, Human HP105047
info info
添加购物车成功! 添加购物车失败!