PPP1CA cDNA ORF Clone, Mouse, N-His tag

Cat: MG50787-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PPP1CA Reagents
CRO Services
Product recommended

All PPP1CA Reagents
PPP1CA cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
993 bp
Description
Full length Clone DNA of Mouse protein phosphatase 1, catalytic subunit, alpha isoform with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PPP1CA cDNA ORF Clone, Mouse, N-His tag Alternative Names
dism2 cDNA ORF Clone, Mouse;Ppp1c cDNA ORF Clone, Mouse
PPP1CA Background Information
Full Name
protein phosphatase 1, catalytic subunit, alpha isozyme

PPP1CA cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
PPP1CA cDNA ORF Clone in Cloning Vector, Ferret FG60154-G
PPP1CA cDNA ORF Clone, Ferret, untagged FG60154-UT
PPP1CA Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60154-ACGLN
PPP1CA cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60154-ACG
PPP1CA cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60154-ANG
PPP1CA cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60154-ACR
PPP1CA cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60154-ANR
PPP1CA cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60154-CF
PPP1CA cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60154-NF
PPP1CA cDNA ORF Clone, Ferret, C-His tag FG60154-CH
PPP1CA cDNA ORF Clone, Ferret, N-His tag FG60154-NH
PPP1CA cDNA ORF Clone, Ferret, C-HA tag FG60154-CY
PPP1CA cDNA ORF Clone, Ferret, N-HA tag FG60154-NY
PPP1CA cDNA ORF Clone, Ferret, C-Myc tag FG60154-CM
PPP1CA cDNA ORF Clone, Ferret, N-Myc tag FG60154-NM

PPP1CA cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
PPP1CA cDNA ORF Clone in Cloning Vector, Rat RG81087-G
PPP1CA cDNA ORF Clone, Rat, untagged RG81087-UT
PPP1CA cDNA ORF Clone, Rat, C-GFPSpark® tag RG81087-ACG
PPP1CA Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81087-ACGLN
PPP1CA cDNA ORF Clone, Rat, N-GFPSpark® tag RG81087-ANG
PPP1CA cDNA ORF Clone, Rat, C-OFPSpark® tag RG81087-ACR
PPP1CA cDNA ORF Clone, Rat, N-OFPSpark® tag RG81087-ANR
PPP1CA cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81087-CF
PPP1CA cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81087-NF
PPP1CA cDNA ORF Clone, Rat, C-His tag RG81087-CH
PPP1CA cDNA ORF Clone, Rat, N-His tag RG81087-NH
PPP1CA cDNA ORF Clone, Rat, C-HA tag RG81087-CY
PPP1CA cDNA ORF Clone, Rat, N-HA tag RG81087-NY
PPP1CA cDNA ORF Clone, Rat, C-Myc tag RG81087-CM
PPP1CA cDNA ORF Clone, Rat, N-Myc tag RG81087-NM
PPP1CA qPCR Primer Pairs, Rat RP301044

PPP1CA cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PPP1CA cDNA ORF Clone in Cloning Vector, Mouse MG50787-G
PPP1CA cDNA ORF Clone, Mouse, untagged MG50787-UT
PPP1CA cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50787-ACG
PPP1CA Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50787-ACGLN
PPP1CA cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50787-ANG
PPP1CA cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50787-ACR
PPP1CA cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50787-ANR
PPP1CA cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50787-CF
PPP1CA cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50787-NF
PPP1CA cDNA ORF Clone, Mouse, C-His tag MG50787-CH
PPP1CA cDNA ORF Clone, Mouse, C-HA tag MG50787-CY
PPP1CA cDNA ORF Clone, Mouse, N-HA tag MG50787-NY
PPP1CA cDNA ORF Clone, Mouse, C-Myc tag MG50787-CM
PPP1CA cDNA ORF Clone, Mouse, N-Myc tag MG50787-NM
PPP1CA qPCR Primer Pairs, Mouse MP200760

PPP1CA cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PPP1CA cDNA ORF Clone in Cloning Vector, Human HG10533-M
PPP1CA cDNA ORF Clone, Human, untagged HG10533-UT
PPP1CA Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10533-ACGLN
PPP1CA cDNA ORF Clone, Human, C-GFPSpark® tag HG10533-ACG
PPP1CA cDNA ORF Clone, Human, N-GFPSpark® tag HG10533-ANG
PPP1CA cDNA ORF Clone, Human, C-OFPSpark® tag HG10533-ACR
PPP1CA cDNA ORF Clone, Human, N-OFPSpark® tag HG10533-ANR
PPP1CA cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10533-CF
PPP1CA cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10533-NF
PPP1CA cDNA ORF Clone, Human, C-His tag HG10533-CH
PPP1CA cDNA ORF Clone, Human, N-His tag HG10533-NH
PPP1CA cDNA ORF Clone, Human, C-HA tag HG10533-CY
PPP1CA cDNA ORF Clone, Human, N-HA tag HG10533-NY
PPP1CA cDNA ORF Clone, Human, C-Myc tag HG10533-CM
PPP1CA cDNA ORF Clone, Human, N-Myc tag HG10533-NM
PPP1CA qPCR Primer Pairs, Human HP100550
info info
添加购物车成功! 添加购物车失败!