PPID cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG51547-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PPID Reagents
CRO Services
Product recommended

All PPID Reagents
PPID cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1113 bp
Description
Full length Clone DNA of Mouse peptidylprolyl isomerase D (cyclophilin D) with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PPID cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
4930564J03Rik cDNA ORF Clone, Mouse;CYP-40 cDNA ORF Clone, Mouse;Ppidl cDNA ORF Clone, Mouse;Ppif cDNA ORF Clone, Mouse
PPID Background Information
Full Name
peptidylprolyl isomerase D

PPID cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
PPID cDNA ORF Clone in Cloning Vector, Rat RG84196-U
PPID Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG84196-ACGLN

PPID cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PPID cDNA ORF Clone in Cloning Vector, Mouse MG51547-U
PPID cDNA ORF Clone, Mouse, untagged MG51547-UT
PPID Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51547-ACGLN
PPID cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51547-ACG
PPID cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51547-ANG
PPID cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51547-ACR
PPID cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51547-ANR
PPID cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51547-CF
PPID cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51547-NF
PPID cDNA ORF Clone, Mouse, C-His tag MG51547-CH
PPID cDNA ORF Clone, Mouse, N-His tag MG51547-NH
PPID cDNA ORF Clone, Mouse, C-HA tag MG51547-CY
PPID cDNA ORF Clone, Mouse, N-HA tag MG51547-NY
PPID cDNA ORF Clone, Mouse, C-Myc tag MG51547-CM
PPID qPCR Primer Pairs, Mouse MP201431

PPID cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PPID cDNA ORF Clone in Cloning Vector, Human HG14408-G
PPID cDNA ORF Clone, Human, untagged HG14408-UT
PPID Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14408-ACGLN
PPID cDNA ORF Clone, Human, C-GFPSpark® tag HG14408-ACG
PPID cDNA ORF Clone, Human, N-GFPSpark® tag HG14408-ANG
PPID cDNA ORF Clone, Human, C-OFPSpark® tag HG14408-ACR
PPID cDNA ORF Clone, Human, N-OFPSpark® tag HG14408-ANR
PPID cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14408-CF
PPID cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14408-NF
PPID cDNA ORF Clone, Human, C-His tag HG14408-CH
PPID cDNA ORF Clone, Human, N-His tag HG14408-NH
PPID cDNA ORF Clone, Human, C-HA tag HG14408-CY
PPID cDNA ORF Clone, Human, N-HA tag HG14408-NY
PPID cDNA ORF Clone, Human, C-Myc tag HG14408-CM
PPID cDNA ORF Clone, Human, N-Myc tag HG14408-NM
PPID qPCR Primer Pairs, Human HP103057
info info
添加购物车成功! 添加购物车失败!