Cyclophilin A cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG50296-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Cyclophilin A Reagents
CRO Services
Product recommended

All Cyclophilin A Reagents
Cyclophilin A cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
495 bp
Description
Full length Clone DNA of Mouse peptidylprolyl isomerase A with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Cyclophilin A cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
2700098C05 cDNA ORF Clone, Mouse;Cphn cDNA ORF Clone, Mouse;CyP-18 cDNA ORF Clone, Mouse;CypA cDNA ORF Clone, Mouse
Cyclophilin A Background Information

Peptidyl-prolyl cis-trans isomerase A, also known as PPIase A, Rotamase A, Cyclophilin A, Cyclosporin A-binding protein, PPIA and CYPA, is a cytoplasm protein which belongs to the cyclophilin-type PPIase family and PPIase A subfamily. Cyclophilins (CyPs) are a family of proteins found in organisms ranging from prokaryotes to humans. These molecules exhibit peptidyl-prolyl isomerase activity, suggesting that they influence the conformation of proteins in cells. PPIA / Cyclophilin A accelerate the folding of proteins. It catalyzes the cis-trans isomerization of proline imidic peptide bonds in oligopeptides. PPIA / Cyclophilin A is secreted by vascular smooth muscle cells in response to inflammatory stimuli, and could thus contribute to atherosclerosis. It is not essential for mammalian cell viability. PPIA / Cyclophilin A can interact with several HIV proteins, including p55 gag, Vpr, and capsid protein, and has been shown to be necessary for the formation of infectious HIV virions.

Full Name
peptidylprolyl isomerase A (cyclophilin A)
References
  • Haendler B., et al.,(1987), Complementary DNA for human T-cell cyclophilin. EMBO J. 6:947-950.
  • Haendler B., et al., (1990), Characterization of the human cyclophilin gene and of related processed pseudogenes.Eur. J. Biochem. 190:477-482.
  • Ota T., et al.,(2004), Complete sequencing and characterization of 21,243 full-length human cDNAs.Nat. Genet. 36:40-45.
  • Cyclophilin A cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Cyclophilin A cDNA ORF Clone in Cloning Vector, Rat RG80767-U
    Cyclophilin A cDNA ORF Clone, Rat, untagged RG80767-UT
    Cyclophilin A Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80767-ACGLN
    Cyclophilin A cDNA ORF Clone, Rat, C-GFPSpark® tag RG80767-ACG
    Cyclophilin A cDNA ORF Clone, Rat, N-GFPSpark® tag RG80767-ANG
    Cyclophilin A cDNA ORF Clone, Rat, C-OFPSpark® tag RG80767-ACR
    Cyclophilin A cDNA ORF Clone, Rat, N-OFPSpark® tag RG80767-ANR
    Cyclophilin A cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80767-CF
    Cyclophilin A cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80767-NF
    Cyclophilin A cDNA ORF Clone, Rat, C-His tag RG80767-CH
    Cyclophilin A cDNA ORF Clone, Rat, N-His tag RG80767-NH
    Cyclophilin A cDNA ORF Clone, Rat, C-HA tag RG80767-CY
    Cyclophilin A cDNA ORF Clone, Rat, N-HA tag RG80767-NY
    Cyclophilin A cDNA ORF Clone, Rat, C-Myc tag RG80767-CM
    Cyclophilin A cDNA ORF Clone, Rat, N-Myc tag RG80767-NM
    Cyclophilin A qPCR Primer Pairs, Rat RP300731

    Cyclophilin A cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Cyclophilin A cDNA ORF Clone in Cloning Vector, Mouse MG50296-M
    Cyclophilin A cDNA ORF Clone, Mouse, untagged MG50296-UT
    Cyclophilin A cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50296-ACG
    Cyclophilin A Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50296-ACGLN
    Cyclophilin A cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50296-ACR
    Cyclophilin A cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50296-CF
    Cyclophilin A cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50296-NF
    Cyclophilin A cDNA ORF Clone, Mouse, C-His tag MG50296-CH
    Cyclophilin A cDNA ORF Clone, Mouse, N-His tag MG50296-NH
    Cyclophilin A cDNA ORF Clone, Mouse, C-HA tag MG50296-CY
    Cyclophilin A cDNA ORF Clone, Mouse, N-HA tag MG50296-NY
    Cyclophilin A cDNA ORF Clone, Mouse, C-Myc tag MG50296-CM
    Cyclophilin A qPCR Primer Pairs, Mouse MP200081

    Cyclophilin A cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Cyclophilin A cDNA ORF Clone in Cloning Vector, Human HG10436-M
    Cyclophilin A cDNA ORF Clone, Human, untagged HG10436-UT
    Cyclophilin A cDNA ORF Clone, Human, C-GFPSpark® tag HG10436-ACG
    Cyclophilin A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10436-ACGLN
    Cyclophilin A cDNA ORF Clone, Human, N-GFPSpark® tag HG10436-ANG
    Cyclophilin A cDNA ORF Clone, Human, C-OFPSpark® tag HG10436-ACR
    Cyclophilin A cDNA ORF Clone, Human, N-OFPSpark® tag HG10436-ANR
    Cyclophilin A cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10436-CF
    Cyclophilin A cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10436-NF
    Cyclophilin A cDNA ORF Clone, Human, C-His tag HG10436-CH
    Cyclophilin A cDNA ORF Clone, Human, N-His tag HG10436-NH
    Cyclophilin A cDNA ORF Clone, Human, C-HA tag HG10436-CY
    Cyclophilin A cDNA ORF Clone, Human, N-HA tag HG10436-NY
    Cyclophilin A cDNA ORF Clone, Human, C-Myc tag HG10436-CM
    Cyclophilin A cDNA ORF Clone, Human, N-Myc tag HG10436-NM
    Cyclophilin A qPCR Primer Pairs, Human HP100010
    info info
    添加购物车成功! 添加购物车失败!