Quick Order

Text Size:AAA

Mouse Cyclophilin A Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Mouse PPIA cDNA Clone Product Information
NCBI RefSeq:NM_008907.1
RefSeq ORF Size:495bp
cDNA Description:Full length Clone DNA of Mus musculus peptidylprolyl isomerase A.
Gene Synonym:Cphn, CypA, CyP-18, 2700098C05, Ppia
Species:Mouse
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Mouse peptidyl-prolyl cis-trans isomerase A, also known as PPIase A, Rotamase A, Cyclophilin A, Cyclosporin A-binding protein, PPIA and CYPA, is a cytoplasm protein which belongs to the cyclophilin-type PPIase family and PPIase A subfamily. Cyclophilins (CyPs) are a family of proteins found in organisms ranging from prokaryotes to humans. These molecules exhibit peptidyl-prolyl isomerase activity, suggesting that they influence the conformation of proteins in cells. PPIA / Cyclophilin A accelerate the folding of proteins. It catalyzes the cis-trans isomerization of proline imidic peptide bonds in oligopeptides. PPIA / Cyclophilin A is secreted by vascular smooth muscle cells in response to inflammatory stimuli, and could thus contribute to atherosclerosis. It is not essential for mammalian cell viability. PPIA / Cyclophilin A can interact with several HIV proteins, including p55 gag, Vpr, and capsid protein, and has been shown to be necessary for the formation of infectious HIV virions.

Size / Price
Catalog: MG50296-UT
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
Availability2-3 weeks
Bulk Discount InquiryAdd to Cart
Contact Us
Images
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"