POLR3K cDNA ORF Clone, Mouse, C-His tag

Cat: MG51827-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All POLR3K Reagents
CRO Services
Product recommended

All POLR3K Reagents
POLR3K cDNA ORF Clone, Mouse, C-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
327 bp
Description
Full length Clone DNA of Mouse polymerase (RNA) III (DNA directed) polypeptide K with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

POLR3K cDNA ORF Clone, Mouse, C-His tag Alternative Names
12.3kDa cDNA ORF Clone, Mouse;1500004O14Rik cDNA ORF Clone, Mouse;AI196849 cDNA ORF Clone, Mouse;AU014893 cDNA ORF Clone, Mouse;C11 cDNA ORF Clone, Mouse;RPC10 cDNA ORF Clone, Mouse;RPC11 cDNA ORF Clone, Mouse
POLR3K Background Information
Full Name
polymerase (RNA) III (DNA directed) polypeptide K, 12.3 kDa

POLR3K cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
POLR3K cDNA ORF Clone in Cloning Vector, Rat RG86470-U
POLR3K Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG86470-ACGLN

POLR3K cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
POLR3K cDNA ORF Clone in Cloning Vector, Mouse MG51827-U
POLR3K cDNA ORF Clone, Mouse, untagged MG51827-UT
POLR3K cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51827-ACG
POLR3K Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51827-ACGLN
POLR3K cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51827-ANG
POLR3K cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51827-ACR
POLR3K cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51827-ANR
POLR3K cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51827-CF
POLR3K cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51827-NF
POLR3K cDNA ORF Clone, Mouse, N-His tag MG51827-NH
POLR3K cDNA ORF Clone, Mouse, C-HA tag MG51827-CY
POLR3K cDNA ORF Clone, Mouse, N-HA tag MG51827-NY
POLR3K cDNA ORF Clone, Mouse, C-Myc tag MG51827-CM
POLR3K cDNA ORF Clone, Mouse, N-Myc tag MG51827-NM
POLR3K qPCR Primer Pairs, Mouse MP201700

POLR3K cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
POLR3K cDNA ORF Clone in Cloning Vector, Human HG21758-U
POLR3K cDNA ORF Clone, Human, untagged HG21758-UT
POLR3K Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG21758-ACGLN
POLR3K cDNA ORF Clone, Human, C-GFPSpark® tag HG21758-ACG
POLR3K cDNA ORF Clone, Human, N-GFPSpark® tag HG21758-ANG
POLR3K cDNA ORF Clone, Human, C-OFPSpark® tag HG21758-ACR
POLR3K cDNA ORF Clone, Human, N-OFPSpark® tag HG21758-ANR
POLR3K cDNA ORF Clone, Human, C-DDK (Flag®) tag HG21758-CF
POLR3K cDNA ORF Clone, Human, N-DDK (Flag®) tag HG21758-NF
POLR3K cDNA ORF Clone, Human, C-His tag HG21758-CH
POLR3K cDNA ORF Clone, Human, N-His tag HG21758-NH
POLR3K cDNA ORF Clone, Human, C-HA tag HG21758-CY
POLR3K cDNA ORF Clone, Human, N-HA tag HG21758-NY
POLR3K cDNA ORF Clone, Human, C-Myc tag HG21758-CM
POLR3K cDNA ORF Clone, Human, N-Myc tag HG21758-NM
info info
添加购物车成功! 添加购物车失败!