PNRC2 cDNA ORF Clone, Mouse, N-His tag

Cat: MG51485-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PNRC2 Reagents
CRO Services
Product recommended

All PNRC2 Reagents
PNRC2 cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
423 bp
Description
Full length Clone DNA of Mouse proline-rich nuclear receptor coactivator 2 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PNRC2 cDNA ORF Clone, Mouse, N-His tag Alternative Names
0610011E17Rik cDNA ORF Clone, Mouse;D4Bwg0593e cDNA ORF Clone, Mouse
PNRC2 Background Information
Full Name
proline-rich nuclear receptor coactivator 2

PNRC2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PNRC2 cDNA ORF Clone in Cloning Vector, Mouse MG51485-G
PNRC2 cDNA ORF Clone, Mouse, untagged MG51485-UT
PNRC2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51485-ACGLN
PNRC2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51485-ACG
PNRC2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51485-ANG
PNRC2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51485-ACR
PNRC2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51485-ANR
PNRC2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51485-CF
PNRC2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51485-NF
PNRC2 cDNA ORF Clone, Mouse, C-His tag MG51485-CH
PNRC2 cDNA ORF Clone, Mouse, C-HA tag MG51485-CY
PNRC2 cDNA ORF Clone, Mouse, N-HA tag MG51485-NY
PNRC2 cDNA ORF Clone, Mouse, C-Myc tag MG51485-CM
PNRC2 cDNA ORF Clone, Mouse, N-Myc tag MG51485-NM
PNRC2 qPCR Primer Pairs, Mouse MP201369

PNRC2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PNRC2 cDNA ORF Clone in Cloning Vector, Human HG23203-U
PNRC2 cDNA ORF Clone, Human, untagged HG23203-UT
PNRC2 cDNA ORF Clone, Human, C-GFPSpark® tag HG23203-ACG
PNRC2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG23203-ACGLN
PNRC2 cDNA ORF Clone, Human, N-GFPSpark® tag HG23203-ANG
PNRC2 cDNA ORF Clone, Human, C-OFPSpark® tag HG23203-ACR
PNRC2 cDNA ORF Clone, Human, N-OFPSpark® tag HG23203-ANR
PNRC2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG23203-CF
PNRC2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG23203-NF
PNRC2 cDNA ORF Clone, Human, C-His tag HG23203-CH
PNRC2 cDNA ORF Clone, Human, N-His tag HG23203-NH
PNRC2 cDNA ORF Clone, Human, C-HA tag HG23203-CY
PNRC2 cDNA ORF Clone, Human, N-HA tag HG23203-NY
PNRC2 cDNA ORF Clone, Human, C-Myc tag HG23203-CM
PNRC2 cDNA ORF Clone, Human, N-Myc tag HG23203-NM
info info
添加购物车成功! 添加购物车失败!