PMPCB cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG53007-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PMPCB Reagents
CRO Services
Product recommended

All PMPCB Reagents
PMPCB cDNA ORF Clone, Mouse, C-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1470 bp
Description
Full length Clone DNA of Mouse peptidase (mitochondrial processing) beta with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PMPCB cDNA ORF Clone, Mouse, C-Myc tag Alternative Names
3110004O18Rik cDNA ORF Clone, Mouse;MPP11 cDNA ORF Clone, Mouse;MPPB cDNA ORF Clone, Mouse;MPPP52 cDNA ORF Clone, Mouse
PMPCB Background Information
Full Name
peptidase (mitochondrial processing) beta

PMPCB cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PMPCB cDNA ORF Clone in Cloning Vector, Mouse MG53007-G
PMPCB cDNA ORF Clone, Mouse, untagged MG53007-UT
PMPCB Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53007-ACGLN
PMPCB cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53007-ACG
PMPCB cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53007-ACR
PMPCB cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53007-CF
PMPCB cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53007-NF
PMPCB cDNA ORF Clone, Mouse, C-His tag MG53007-CH
PMPCB cDNA ORF Clone, Mouse, N-His tag MG53007-NH
PMPCB cDNA ORF Clone, Mouse, C-HA tag MG53007-CY
PMPCB cDNA ORF Clone, Mouse, N-HA tag MG53007-NY
PMPCB cDNA ORF Clone, Mouse, N-Myc tag MG53007-NM

PMPCB cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PMPCB cDNA ORF Clone in Cloning Vector, Human HG16172-G
PMPCB cDNA ORF Clone, Human, untagged HG16172-UT
PMPCB cDNA ORF Clone, Human, C-GFPSpark® tag HG16172-ACG
PMPCB Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16172-ACGLN
PMPCB cDNA ORF Clone, Human, N-GFPSpark® tag HG16172-ANG
PMPCB cDNA ORF Clone, Human, C-OFPSpark® tag HG16172-ACR
PMPCB cDNA ORF Clone, Human, N-OFPSpark® tag HG16172-ANR
PMPCB cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16172-CF
PMPCB cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16172-NF
PMPCB cDNA ORF Clone, Human, C-His tag HG16172-CH
PMPCB cDNA ORF Clone, Human, N-His tag HG16172-NH
PMPCB cDNA ORF Clone, Human, C-HA tag HG16172-CY
PMPCB cDNA ORF Clone, Human, N-HA tag HG16172-NY
PMPCB cDNA ORF Clone, Human, C-Myc tag HG16172-CM
PMPCB cDNA ORF Clone, Human, N-Myc tag HG16172-NM
PMPCB qPCR Primer Pairs, Human HP104941
info info
添加购物车成功! 添加购物车失败!