PMM1 cDNA ORF Clone, Mouse, untagged

Cat: MG51416-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PMM1 Reagents
CRO Services
Product recommended

All PMM1 Reagents
PMM1 cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
789 bp
Description
Full length Clone DNA of Mouse phosphomannomutase 1.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PMM1 cDNA ORF Clone, Mouse, untagged Alternative Names
C77612 cDNA ORF Clone, Mouse
PMM1 Background Information
Full Name
phosphomannomutase 1

PMM1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
PMM1 cDNA ORF Clone in Cloning Vector, Rat RG8A1549-U
PMM1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A1549-ACGLN

PMM1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PMM1 cDNA ORF Clone in Cloning Vector, Mouse MG51416-G
PMM1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51416-ACG
PMM1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51416-ACGLN
PMM1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51416-ANG
PMM1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51416-ACR
PMM1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51416-ANR
PMM1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51416-CF
PMM1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51416-NF
PMM1 cDNA ORF Clone, Mouse, C-His tag MG51416-CH
PMM1 cDNA ORF Clone, Mouse, N-His tag MG51416-NH
PMM1 cDNA ORF Clone, Mouse, C-HA tag MG51416-CY
PMM1 cDNA ORF Clone, Mouse, N-HA tag MG51416-NY
PMM1 cDNA ORF Clone, Mouse, C-Myc tag MG51416-CM
PMM1 cDNA ORF Clone, Mouse, N-Myc tag MG51416-NM
PMM1 qPCR Primer Pairs, Mouse MP201300

PMM1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PMM1 cDNA ORF Clone in Cloning Vector, Human HG12922-U
PMM1 cDNA ORF Clone, Human, untagged HG12922-UT
PMM1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12922-ACGLN
PMM1 cDNA ORF Clone, Human, C-GFPSpark® tag HG12922-ACG
PMM1 cDNA ORF Clone, Human, N-GFPSpark® tag HG12922-ANG
PMM1 cDNA ORF Clone, Human, C-OFPSpark® tag HG12922-ACR
PMM1 cDNA ORF Clone, Human, N-OFPSpark® tag HG12922-ANR
PMM1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12922-CF
PMM1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12922-NF
PMM1 cDNA ORF Clone, Human, C-His tag HG12922-CH
PMM1 cDNA ORF Clone, Human, N-His tag HG12922-NH
PMM1 cDNA ORF Clone, Human, C-HA tag HG12922-CY
PMM1 cDNA ORF Clone, Human, N-HA tag HG12922-NY
PMM1 cDNA ORF Clone, Human, C-Myc tag HG12922-CM
PMM1 cDNA ORF Clone, Human, N-Myc tag HG12922-NM
info info
添加购物车成功! 添加购物车失败!