T Plastin cDNA ORF Clone, Mouse, N-HA tag

Cat: MG52182-NY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All T Plastin Reagents
CRO Services
Product recommended

All T Plastin Reagents
T Plastin cDNA ORF Clone, Mouse, N-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1893 bp
Description
Full length Clone DNA of Mouse plastin 3 (T-isoform) with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

T Plastin cDNA ORF Clone, Mouse, N-HA tag Alternative Names
AI115446 cDNA ORF Clone, Mouse;AL024105 cDNA ORF Clone, Mouse;T-fimbrin cDNA ORF Clone, Mouse
T Plastin Background Information

PLS3, also known as plastin 3, belongs to the plastin family. Members of this family are actin-binding proteins that are conserved throughout eukaryote evolution and expressed in most tissues of higher eukaryotes. There are two ubiquitous plastin isoforms in humans: L and T. The L isoform is expressed only in hemopoietic cell lineages, while the T isoform has been found in all other normal cells of solid tissues that have replicative potential (fibroblasts, endothelial cells, epithelial cells, melanocytes, etc.). PLS3 contains 2 actin-binding domains, 4 CH (calponin-homology) domains and 2 EF-hand domains. It is expressed in a variety of organs, including muscle, brain, uterus and esophagus.

Full Name
plastin 3
References
  • Lin CS. et al., 1993, J Biol Chem 268 (4): 2781-92.
  • Goldstein D. et al., 1985, Cancer Res. 45 (2): 5643-7.
  • Arpin M. et al., 1995, J Cell Biol. 127 (2): 1995-2008.
  • T Plastin cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    T Plastin cDNA ORF Clone in Cloning Vector, Mouse MG52182-G
    T Plastin cDNA ORF Clone, Mouse, untagged MG52182-UT
    T Plastin Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52182-ACGLN
    T Plastin cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52182-ACG
    T Plastin cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52182-ANG
    T Plastin cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52182-ACR
    T Plastin cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52182-ANR
    T Plastin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52182-CF
    T Plastin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52182-NF
    T Plastin cDNA ORF Clone, Mouse, C-His tag MG52182-CH
    T Plastin cDNA ORF Clone, Mouse, N-His tag MG52182-NH
    T Plastin cDNA ORF Clone, Mouse, C-HA tag MG52182-CY
    T Plastin cDNA ORF Clone, Mouse, C-Myc tag MG52182-CM
    T Plastin cDNA ORF Clone, Mouse, N-Myc tag MG52182-NM
    T Plastin qPCR Primer Pairs, Mouse MP202055

    T Plastin cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    T Plastin cDNA ORF Clone in Cloning Vector, Human HG15042-G
    T Plastin cDNA ORF Clone, Human, untagged HG15042-UT
    T Plastin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15042-ACGLN
    T Plastin cDNA ORF Clone, Human, C-GFPSpark® tag HG15042-ACG
    T Plastin cDNA ORF Clone, Human, N-GFPSpark® tag HG15042-ANG
    T Plastin cDNA ORF Clone, Human, C-OFPSpark® tag HG15042-ACR
    T Plastin cDNA ORF Clone, Human, N-OFPSpark® tag HG15042-ANR
    T Plastin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15042-CF
    T Plastin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15042-NF
    T Plastin cDNA ORF Clone, Human, C-His tag HG15042-CH
    T Plastin cDNA ORF Clone, Human, N-His tag HG15042-NH
    T Plastin cDNA ORF Clone, Human, C-HA tag HG15042-CY
    T Plastin cDNA ORF Clone, Human, N-HA tag HG15042-NY
    T Plastin cDNA ORF Clone, Human, C-Myc tag HG15042-CM
    T Plastin cDNA ORF Clone, Human, N-Myc tag HG15042-NM
    T Plastin qPCR Primer Pairs, Human HP103670
    info info
    添加购物车成功! 添加购物车失败!