PLRG1 cDNA ORF Clone, Mouse, C-His tag

Cat: MG52350-CH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All PLRG1 Reagents
CRO Services
Product recommended

All PLRG1 Reagents
PLRG1 cDNA ORF Clone, Mouse, C-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1542 bp
Description
Full length Clone DNA of Mouse pleiotropic regulator 1, PRL1 homolog (Arabidopsis) with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PLRG1 cDNA ORF Clone, Mouse, C-His tag Alternative Names
AA958940 cDNA ORF Clone, Mouse;C80566 cDNA ORF Clone, Mouse;Tango4 cDNA ORF Clone, Mouse
PLRG1 Background Information
Full Name
pleiotropic regulator 1

PLRG1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
PLRG1 cDNA ORF Clone in Cloning Vector, Rat RG80639-U
PLRG1 cDNA ORF Clone, Rat, untagged RG80639-UT
PLRG1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80639-ACG
PLRG1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80639-ACGLN
PLRG1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80639-ANG
PLRG1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80639-ACR
PLRG1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80639-ANR
PLRG1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80639-CF
PLRG1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80639-NF
PLRG1 cDNA ORF Clone, Rat, C-His tag RG80639-CH
PLRG1 cDNA ORF Clone, Rat, N-His tag RG80639-NH
PLRG1 cDNA ORF Clone, Rat, C-HA tag RG80639-CY
PLRG1 cDNA ORF Clone, Rat, N-HA tag RG80639-NY
PLRG1 cDNA ORF Clone, Rat, C-Myc tag RG80639-CM
PLRG1 cDNA ORF Clone, Rat, N-Myc tag RG80639-NM
PLRG1 qPCR Primer Pairs, Rat RP300603

PLRG1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PLRG1 cDNA ORF Clone in Cloning Vector, Mouse MG52350-U
PLRG1 cDNA ORF Clone, Mouse, untagged MG52350-UT
PLRG1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52350-ACGLN
PLRG1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52350-ACG
PLRG1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52350-ANG
PLRG1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52350-ACR
PLRG1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52350-ANR
PLRG1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52350-CF
PLRG1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52350-NF
PLRG1 cDNA ORF Clone, Mouse, N-His tag MG52350-NH
PLRG1 cDNA ORF Clone, Mouse, C-HA tag MG52350-CY
PLRG1 cDNA ORF Clone, Mouse, N-HA tag MG52350-NY
PLRG1 cDNA ORF Clone, Mouse, C-Myc tag MG52350-CM
PLRG1 cDNA ORF Clone, Mouse, N-Myc tag MG52350-NM
PLRG1 qPCR Primer Pairs, Mouse MP202223

PLRG1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PLRG1 cDNA ORF Clone in Cloning Vector, Human HG15324-G
PLRG1 cDNA ORF Clone, Human, untagged HG15324-UT
PLRG1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15324-ACGLN
PLRG1 cDNA ORF Clone, Human, C-GFPSpark® tag HG15324-ACG
PLRG1 cDNA ORF Clone, Human, N-GFPSpark® tag HG15324-ANG
PLRG1 cDNA ORF Clone, Human, C-OFPSpark® tag HG15324-ACR
PLRG1 cDNA ORF Clone, Human, N-OFPSpark® tag HG15324-ANR
PLRG1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15324-CF
PLRG1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15324-NF
PLRG1 cDNA ORF Clone, Human, C-His tag HG15324-CH
PLRG1 cDNA ORF Clone, Human, N-His tag HG15324-NH
PLRG1 cDNA ORF Clone, Human, C-HA tag HG15324-CY
PLRG1 cDNA ORF Clone, Human, N-HA tag HG15324-NY
PLRG1 cDNA ORF Clone, Human, C-Myc tag HG15324-CM
PLRG1 cDNA ORF Clone, Human, N-Myc tag HG15324-NM
PLRG1 qPCR Primer Pairs, Human HP103949
info info
添加购物车成功! 添加购物车失败!