PLK4 cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG50906-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PLK4 Reagents
CRO Services
Product recommended

All PLK4 Reagents
PLK4 cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2778 bp
Description
Full length Clone DNA of Mouse polo-like kinase 4 (Drosophila) with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PLK4 cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
1700028H20 cDNA ORF Clone, Mouse;AI385771 cDNA ORF Clone, Mouse;Sak cDNA ORF Clone, Mouse;Stk18 cDNA ORF Clone, Mouse
PLK4 Background Information
Full Name
polo like kinase 4

PLK4 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PLK4 cDNA ORF Clone in Cloning Vector, Mouse MG50906-G
PLK4 cDNA ORF Clone, Mouse, untagged MG50906-UT
PLK4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50906-ACGLN
PLK4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50906-ACG
PLK4 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50906-ANG
PLK4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50906-ACR
PLK4 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50906-ANR
PLK4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50906-CF
PLK4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50906-NF
PLK4 cDNA ORF Clone, Mouse, C-His tag MG50906-CH
PLK4 cDNA ORF Clone, Mouse, N-His tag MG50906-NH
PLK4 cDNA ORF Clone, Mouse, C-HA tag MG50906-CY
PLK4 cDNA ORF Clone, Mouse, N-HA tag MG50906-NY
PLK4 cDNA ORF Clone, Mouse, C-Myc tag MG50906-CM
PLK4 qPCR Primer Pairs, Mouse MP200877

PLK4 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PLK4 cDNA ORF Clone in Cloning Vector, Human HG10659-M
PLK4 cDNA ORF Clone, Human, untagged HG10659-UT
PLK4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10659-ACGLN
PLK4 cDNA ORF Clone, Human, C-GFPSpark® tag HG10659-ACG
PLK4 cDNA ORF Clone, Human, N-GFPSpark® tag HG10659-ANG
PLK4 cDNA ORF Clone, Human, C-OFPSpark® tag HG10659-ACR
PLK4 cDNA ORF Clone, Human, N-OFPSpark® tag HG10659-ANR
PLK4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10659-CF
PLK4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10659-NF
PLK4 cDNA ORF Clone, Human, C-His tag HG10659-CH
PLK4 cDNA ORF Clone, Human, N-His tag HG10659-NH
PLK4 cDNA ORF Clone, Human, C-HA tag HG10659-CY
PLK4 cDNA ORF Clone, Human, N-HA tag HG10659-NY
PLK4 cDNA ORF Clone, Human, C-Myc tag HG10659-CM
PLK4 cDNA ORF Clone, Human, N-Myc tag HG10659-NM
PLK4 qPCR Primer Pairs, Human HP100628
info info
添加购物车成功! 添加购物车失败!