PLK1 cDNA ORF Clone, Mouse, C-HA tag

Cat: MG50624-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PLK1 Reagents
CRO Services
Product recommended

All PLK1 Reagents
PLK1 cDNA ORF Clone, Mouse, C-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1812 bp
Description
Full length Clone DNA of Mouse polo-like kinase 1 (Drosophila) with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PLK1 cDNA ORF Clone, Mouse, C-HA tag Alternative Names
Plk cDNA ORF Clone, Mouse;STPK13 cDNA ORF Clone, Mouse
PLK1 Background Information

Serine / threonine-protein kinase PLK1 / PLK-1, also known as polo-like kinase 1 (PLK-1) or serine / threonine-protein kinase 13 (STPK13), Polo-like kinases (PLKs), is a family of four serine / threonine protein kinases that are critical regulators of cell cycle progression, mitosis, cytokinesis, and the DNA damage response. PLK1 / PLK-1 is ubiquitously expressed. The mRNA and protein expression of PLK1 / PLK-1, -2 and -4 are coordinately regulated during cell cycle progression, but PLK3 levels are independent of the other three family members. PLK1 / PLK-1 is the most well characterized member of this family and strongly promotes the progression of cells through mitosis. During the various stages of mitosis PLK1 / PLK-1 localizes to the centrosomes, kinetochores and central spindle. PLKs are dysregulated in a variety of human cancers. PLK1 / PLK-1 overexpression correlates with cellular proliferation and poor prognosis. Serine / threonine-protein kinase that performs several important functions throughout M phase of the cell cycle, including the regulation of centrosome maturation and spindle assembly, the removal of cohesins from chromosome arms, the inactivation of APC / C inhibitors, and the regulation of mitotic exit and cytokinesis. It is required for recovery after DNA damage checkpoint and entry into mitosis. PLK1 / PLK-1 is required for kinetochore localization of BUB1B, spindle pole localization of isoform 3 of SGOL1 and plays a role in regulating its centriole cohesion function. PLK1 / PLK-1 Phosphorylates BORA, and thereby promotes the degradation of BORA. PLK1 / PLK-1 also contributes to the regulation of AURKA function and phosphorylates SGOL1.

Full Name
polo-like kinase 1
References
  • Lee KS, et al. (2008) Self-regulated mechanism of Plk1 localization to kinetochores: lessons from the Plk1-PBIP1 interaction. Cell Div. 3: 4.
  • Zhou T, et al. (2003) A role for Plk1 phosphorylation of NudC in cytokinesis. Dev Cell. 5 (1): 127-38.
  • Lee M, et al. (2004) Phosphorylation of BRCA2 by the Polo-like kinase Plk1 is regulated by DNA damage and mitotic progression. Oncogene. 23 (4): 865-72.
  • PLK1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    PLK1 cDNA ORF Clone in Cloning Vector, Mouse MG50624-M
    PLK1 cDNA ORF Clone, Mouse, untagged MG50624-UT
    PLK1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50624-ACGLN
    PLK1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50624-ACG
    PLK1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50624-ANG
    PLK1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50624-ACR
    PLK1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50624-ANR
    PLK1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50624-CF
    PLK1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50624-NF
    PLK1 cDNA ORF Clone, Mouse, C-His tag MG50624-CH
    PLK1 cDNA ORF Clone, Mouse, N-His tag MG50624-NH
    PLK1 cDNA ORF Clone, Mouse, N-HA tag MG50624-NY
    PLK1 cDNA ORF Clone, Mouse, C-Myc tag MG50624-CM
    PLK1 cDNA ORF Clone, Mouse, N-Myc tag MG50624-NM
    PLK1 qPCR Primer Pairs, Mouse MP200609

    PLK1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    PLK1 cDNA ORF Clone in Cloning Vector, Human HG10676-M
    PLK1 cDNA ORF Clone, Human, untagged HG10676-UT
    PLK1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10676-ACGLN
    PLK1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10676-ACG
    PLK1 cDNA ORF Clone, Human, N-GFPSpark® tag HG10676-ANG
    PLK1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10676-ACR
    PLK1 cDNA ORF Clone, Human, N-OFPSpark® tag HG10676-ANR
    PLK1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10676-CF
    PLK1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10676-NF
    PLK1 cDNA ORF Clone, Human, C-His tag HG10676-CH
    PLK1 cDNA ORF Clone, Human, N-His tag HG10676-NH
    PLK1 cDNA ORF Clone, Human, C-HA tag HG10676-CY
    PLK1 cDNA ORF Clone, Human, N-HA tag HG10676-NY
    PLK1 cDNA ORF Clone, Human, C-Myc tag HG10676-CM
    PLK1 cDNA ORF Clone, Human, N-Myc tag HG10676-NM
    PLK1 qPCR Primer Pairs, Human HP100641
    info info
    添加购物车成功! 添加购物车失败!