PLEKHB1 cDNA ORF Clone, Mouse, C-HA tag

Cat: MG51828-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PLEKHB1 Reagents
CRO Services
Product recommended

All PLEKHB1 Reagents
PLEKHB1 cDNA ORF Clone, Mouse, C-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
570 bp
Description
Full length Clone DNA of Mouse pleckstrin homology domain containing, family B (evectins) member 1 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PLEKHB1 cDNA ORF Clone, Mouse, C-HA tag Alternative Names
AI315628 cDNA ORF Clone, Mouse;evt-1 cDNA ORF Clone, Mouse;PHR1 cDNA ORF Clone, Mouse;Phret1 cDNA ORF Clone, Mouse
PLEKHB1 Background Information
Full Name
pleckstrin homology domain containing, family B (evectins) member 1

PLEKHB1 cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
PLEKHB1 cDNA ORF Clone in Cloning Vector, Canine DG70158-U

PLEKHB1 cDNA ORF Clone, Rabbit, Related Products

Product Name Catalog#(PDF)
PLEKHB1 cDNA ORF Clone in Cloning Vector, Rabbit TG65107-G
PLEKHB1 cDNA ORF Clone, Rabbit, untagged TG65107-UT
PLEKHB1 cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65107-ACG
PLEKHB1 cDNA ORF Clone, Rabbit, N-GFPSpark® tag TG65107-ANG
PLEKHB1 cDNA ORF Clone, Rabbit, C-OFPSpark® tag TG65107-ACR
PLEKHB1 cDNA ORF Clone, Rabbit, N-OFPSpark® tag TG65107-ANR
PLEKHB1 cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag TG65107-CF
PLEKHB1 cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag TG65107-NF
PLEKHB1 cDNA ORF Clone, Rabbit, C-His tag TG65107-CH
PLEKHB1 cDNA ORF Clone, Rabbit, N-His tag TG65107-NH
PLEKHB1 cDNA ORF Clone, Rabbit, C-HA tag TG65107-CY
PLEKHB1 cDNA ORF Clone, Rabbit, N-HA tag TG65107-NY
PLEKHB1 cDNA ORF Clone, Rabbit, C-Myc tag TG65107-CM
PLEKHB1 cDNA ORF Clone, Rabbit, N-Myc tag TG65107-NM

PLEKHB1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PLEKHB1 cDNA ORF Clone in Cloning Vector, Mouse MG51828-U
PLEKHB1 cDNA ORF Clone, Mouse, untagged MG51828-UT
PLEKHB1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51828-ACGLN
PLEKHB1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51828-ACG
PLEKHB1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51828-ANG
PLEKHB1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51828-ACR
PLEKHB1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51828-ANR
PLEKHB1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51828-CF
PLEKHB1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51828-NF
PLEKHB1 cDNA ORF Clone, Mouse, C-His tag MG51828-CH
PLEKHB1 cDNA ORF Clone, Mouse, N-His tag MG51828-NH
PLEKHB1 cDNA ORF Clone, Mouse, N-HA tag MG51828-NY
PLEKHB1 cDNA ORF Clone, Mouse, C-Myc tag MG51828-CM
PLEKHB1 cDNA ORF Clone, Mouse, N-Myc tag MG51828-NM
PLEKHB1 qPCR Primer Pairs, Mouse MP201701

PLEKHB1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PLEKHB1 cDNA ORF Clone in Cloning Vector, Human HG23620-U
info info
添加购物车成功! 添加购物车失败!