PLD3 cDNA ORF Clone, Mouse, untagged

Cat: MG51521-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All PLD3 Reagents
CRO Services
Product recommended

All PLD3 Reagents
PLD3 cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1467 bp
Description
Full length Clone DNA of Mouse phospholipase D family, member 3.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PLD3 cDNA ORF Clone, Mouse, untagged Alternative Names
Sam-9 cDNA ORF Clone, Mouse
PLD3 Background Information
Full Name
phospholipase D family, member 3

PLD3 cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
PLD3 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90474-G
PLD3 cDNA ORF Clone, Cynomolgus, untagged CG90474-UT
PLD3 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90474-ACGLN
PLD3 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90474-ACG
PLD3 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90474-ACR
PLD3 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90474-CF
PLD3 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90474-NF
PLD3 cDNA ORF Clone, Cynomolgus, C-His tag CG90474-CH
PLD3 cDNA ORF Clone, Cynomolgus, N-His tag CG90474-NH
PLD3 cDNA ORF Clone, Cynomolgus, C-HA tag CG90474-CY
PLD3 cDNA ORF Clone, Cynomolgus, N-HA tag CG90474-NY
PLD3 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90474-CM
PLD3 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90474-NM

PLD3 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
PLD3 cDNA ORF Clone in Cloning Vector, Rat RG81246-U
PLD3 cDNA ORF Clone, Rat, untagged RG81246-UT
PLD3 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81246-ACGLN
PLD3 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81246-ACG
PLD3 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81246-ACR
PLD3 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81246-CF
PLD3 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81246-NF
PLD3 cDNA ORF Clone, Rat, C-His tag RG81246-CH
PLD3 cDNA ORF Clone, Rat, N-His tag RG81246-NH
PLD3 cDNA ORF Clone, Rat, C-HA tag RG81246-CY
PLD3 cDNA ORF Clone, Rat, N-HA tag RG81246-NY
PLD3 cDNA ORF Clone, Rat, C-Myc tag RG81246-CM
PLD3 cDNA ORF Clone, Rat, N-Myc tag RG81246-NM
PLD3 qPCR Primer Pairs, Rat RP301202

PLD3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PLD3 cDNA ORF Clone in Cloning Vector, Mouse MG51521-G
PLD3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51521-ACGLN
PLD3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51521-ACG
PLD3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51521-ACR
PLD3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51521-CF
PLD3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51521-NF
PLD3 cDNA ORF Clone, Mouse, C-His tag MG51521-CH
PLD3 cDNA ORF Clone, Mouse, N-His tag MG51521-NH
PLD3 cDNA ORF Clone, Mouse, C-HA tag MG51521-CY
PLD3 cDNA ORF Clone, Mouse, N-HA tag MG51521-NY
PLD3 cDNA ORF Clone, Mouse, C-Myc tag MG51521-CM
PLD3 cDNA ORF Clone, Mouse, N-Myc tag MG51521-NM
PLD3 qPCR Primer Pairs, Mouse MP201405

PLD3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PLD3 cDNA ORF Clone in Cloning Vector, Human HG16349-G
PLD3 cDNA ORF Clone, Human, untagged HG16349-UT
PLD3 cDNA ORF Clone, Human, untagged HG12532-UT
PLD3 cDNA ORF Clone, Human, C-GFPSpark® tag HG16349-ACG
PLD3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12532-ACGLN
PLD3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16349-ACGLN
PLD3 cDNA ORF Clone, Human, C-OFPSpark® tag HG16349-ACR
PLD3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16349-CF
PLD3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16349-NF
PLD3 cDNA ORF Clone, Human, C-His tag HG16349-CH
PLD3 cDNA ORF Clone, Human, N-His tag HG16349-NH
PLD3 cDNA ORF Clone, Human, C-HA tag HG16349-CY
PLD3 cDNA ORF Clone, Human, N-HA tag HG16349-NY
PLD3 cDNA ORF Clone, Human, C-Myc tag HG16349-CM
PLD3 cDNA ORF Clone, Human, N-Myc tag HG16349-NM
PLD3 qPCR Primer Pairs, Human HP104846
info info
添加购物车成功! 添加购物车失败!