Lp-PLA2 cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG51562-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Lp-PLA2 Reagents
CRO Services
Product recommended

All Lp-PLA2 Reagents
Lp-PLA2 cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1323 bp
Description
Full length Clone DNA of Mouse phospholipase A2, group VII (platelet-activating factor acetylhydrolase, plasma) with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Lp-PLA2 cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
R75400 cDNA ORF Clone, Mouse
Lp-PLA2 Background Information

Platelet-activating factor acetylhydrolase, also known as 1-alkyl-2-acetylglycerophosphocholine esterase, 2-acetyl-1-alkylglycero-phosphocholine esterase, Group-VIIA phospholipase A2, LDL-associated phospholipase A2, PAF 2-acylhydrolase, PLA2G7 and PAFAH, is secreted protein which belongs to the AB hydrolase superfamily and Lipase family. PLA2G7 / PAFAH modulates the action of platelet-activating factor (PAF) by hydrolyzing the sn-2 ester bond to yield the biologically inactive lyso-PAF. It has a specificity for substrates with a short residue at the sn-2 position. It is inactive against long-chain phospholipids. PLA2G7 / PAFAH is a potent pro- and anti-inflammatory molecule that has been implicated in multiple inflammatory disease processes, including cardiovascular disease. PLA2G7 also represents an important, potentially functional candidate in the pathophysiology of coronary artery disease (CAD). Defects in PLA2G7 are the cause of platelet-activating factor acetylhydrolase deficiency (PLA2G7 deficiency). It is a trait which is present in 27% of Japanese. It could have a significant physiologic effect in the presence of inflammatory bodily responses.

Full Name
phospholipase A2 group VII
References
  • Stafforini D.M., et al., 1996, J. Clin. Invest. 97:2784-2791.
  • Yoshida H., et al., 1998, Thromb. Haemost. 80:372-375.
  • Yamada Y., et al., 1998, Metabolism 47:177-181.
  • Kruse S., et al., 2000, Am. J. Hum. Genet. 66:1522-1530. 
  • Lp-PLA2 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Lp-PLA2 cDNA ORF Clone in Cloning Vector, Rat RG82241-U
    Lp-PLA2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG82241-ACGLN

    Lp-PLA2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Lp-PLA2 cDNA ORF Clone in Cloning Vector, Mouse MG51562-G
    Lp-PLA2 cDNA ORF Clone, Mouse, untagged MG51562-UT
    Lp-PLA2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51562-ACGLN
    Lp-PLA2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51562-ACG
    Lp-PLA2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51562-ACR
    Lp-PLA2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51562-CF
    Lp-PLA2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51562-NF
    Lp-PLA2 cDNA ORF Clone, Mouse, C-His tag MG51562-CH
    Lp-PLA2 cDNA ORF Clone, Mouse, N-His tag MG51562-NH
    Lp-PLA2 cDNA ORF Clone, Mouse, C-HA tag MG51562-CY
    Lp-PLA2 cDNA ORF Clone, Mouse, N-HA tag MG51562-NY
    Lp-PLA2 cDNA ORF Clone, Mouse, C-Myc tag MG51562-CM
    Lp-PLA2 qPCR Primer Pairs, Mouse MP201445

    Lp-PLA2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Lp-PLA2 cDNA ORF Clone in Cloning Vector, Human HG10848-M
    Lp-PLA2 cDNA ORF Clone, Human, untagged HG10848-UT
    Lp-PLA2 cDNA ORF Clone, Human, C-GFPSpark® tag HG10848-ACG
    Lp-PLA2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10848-ACGLN
    Lp-PLA2 cDNA ORF Clone, Human, C-OFPSpark® tag HG10848-ACR
    Lp-PLA2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10848-CF
    Lp-PLA2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10848-NF
    Lp-PLA2 cDNA ORF Clone, Human, C-His tag HG10848-CH
    Lp-PLA2 cDNA ORF Clone, Human, N-His tag HG10848-NH
    Lp-PLA2 cDNA ORF Clone, Human, C-HA tag HG10848-CY
    Lp-PLA2 cDNA ORF Clone, Human, N-HA tag HG10848-NY
    Lp-PLA2 cDNA ORF Clone, Human, C-Myc tag HG10848-CM
    Lp-PLA2 cDNA ORF Clone, Human, N-Myc tag HG10848-NM
    Lp-PLA2 qPCR Primer Pairs, Human HP100745
    info info
    添加购物车成功! 添加购物车失败!