Quick Order

Mouse PLA2G7/PAFAH Gene ORF cDNA clone expression plasmid

    DatasheetReviewsRelated ProductsProtocols
    Mouse PLA2G7 cDNA Clone Product Information
    NCBI RefSeq:NM_013737.5
    RefSeq ORF Size:1323bp
    cDNA Description:Full length Clone DNA of Mus musculus phospholipase A2, group VII (platelet-activating factor acetylhydrolase, plasma).
    Gene Synonym:R75400
    Species:Mouse
    Vector:pCMV3-untagged
    Plasmid:
    Restriction Site:
    Tag Sequence:
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with PLA2G7 qPCR primers for gene expression analysis, MP201445 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    Product nameProduct name
    Background

    Platelet-activating factor acetylhydrolase, also known as 1-alkyl-2-acetylglycerophosphocholine esterase, 2-acetyl-1-alkylglycero-phosphocholine esterase, Group-VIIA phospholipase A2, LDL-associated phospholipase A2, PAF 2-acylhydrolase, PLA2G7 and PAFAH, is secreted protein which belongs to the AB hydrolase superfamily and Lipase family. PLA2G7 / PAFAH modulates the action of platelet-activating factor (PAF) by hydrolyzing the sn-2 ester bond to yield the biologically inactive lyso-PAF. It has a specificity for substrates with a short residue at the sn-2 position. It is inactive against long-chain phospholipids. PLA2G7 / PAFAH is a potent pro- and anti-inflammatory molecule that has been implicated in multiple inflammatory disease processes, including cardiovascular disease. PLA2G7 also represents an important, potentially functional candidate in the pathophysiology of coronary artery disease (CAD). Defects in PLA2G7 are the cause of platelet-activating factor acetylhydrolase deficiency (PLA2G7 deficiency). It is a trait which is present in 27% of Japanese. It could have a significant physiologic effect in the presence of inflammatory bodily responses.

    References
  • Stafforini D.M., et al., 1996, J. Clin. Invest. 97:2784-2791.
  • Yoshida H., et al., 1998, Thromb. Haemost. 80:372-375.
  • Yamada Y., et al., 1998, Metabolism 47:177-181.
  • Kruse S., et al., 2000, Am. J. Hum. Genet. 66:1522-1530. 
  • Size / Price
    Catalog: MG51562-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"