PLA2G1B cDNA ORF Clone, Mouse, untagged

Cat: MG50329-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PLA2G1B Reagents
CRO Services
Product recommended

All PLA2G1B Reagents
PLA2G1B cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
441 bp
Description
Full length Clone DNA of Mouse phospholipase A2, group IB, pancreas.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PLA2G1B cDNA ORF Clone, Mouse, untagged Alternative Names
Pla2a cDNA ORF Clone, Mouse;sPLA2IB cDNA ORF Clone, Mouse
PLA2G1B Background Information

phospholipase A2, also known as Phosphatidylcholine 2-acylhydrolase 1B, Group IB phospholipase A2, PLA2 and PLA2G1B, is a secreted protein which belongs to the phospholipase A2 family. Phospholipase A2 / PLA2G1B catalyzes the release of fatty acids from glycero-3-phosphocholines. The best known varieties are the digestive enzymes secreted as zymogens by the pancreas of mammals. Sequences of pancreatic Phospholipase A2 / PLA2G1B enzymes from a variety of mammals have been reported. One striking feature of these enzymes is their close homology to venom phospholipases of snakes. Other forms of Phospholipase A2 / PLA2G1B have been isolated from brain, liver, lung, spleen, intestine, macrophages, leukocytes, erythrocytes, inflammatory exudates, chondrocytes, and platelets. Mice lacking in Phospholipase A2 / PLA2G1B are resistant to obesity and diabetes induced by feeding a diabetogenic high-fat/high-carbohydrate diet. Oral supplementation of a diabetogenic diet with the PLA2G1B inhibitor methyl indoxam effectively suppresses diet-induced obesity and diabetes. PLA2G1B inhibition may be a potentially effective oral therapeutic option for treatment of obesity and diabetes.

Full Name
phospholipase A2, group IB (pancreas)
References
  • Labonté,E.D. et al., 2006, Diabetes. 55 (4) :935-41.
  • Mounier,C.M. et al.,2008, Br J Cancer. 98 (3):587-95.
  • Hui,D.Y. et al., 2009, Br J Pharmacol. 157 (7):1263-9.
  • Labonté,E.D. et al., 2010, FASEB J. 24 (7):2516-24.
  • PLA2G1B cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    PLA2G1B cDNA ORF Clone in Cloning Vector, Mouse MG50329-M
    PLA2G1B cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50329-ACG
    PLA2G1B Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50329-ACGLN
    PLA2G1B cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50329-ACR
    PLA2G1B cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50329-CF
    PLA2G1B cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50329-NF
    PLA2G1B cDNA ORF Clone, Mouse, C-His tag MG50329-CH
    PLA2G1B cDNA ORF Clone, Mouse, N-His tag MG50329-NH
    PLA2G1B cDNA ORF Clone, Mouse, C-HA tag MG50329-CY
    PLA2G1B cDNA ORF Clone, Mouse, N-HA tag MG50329-NY
    PLA2G1B cDNA ORF Clone, Mouse, C-Myc tag MG50329-CM
    PLA2G1B cDNA ORF Clone, Mouse, N-Myc tag MG50329-NM
    PLA2G1B qPCR Primer Pairs, Mouse MP200352

    PLA2G1B cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    PLA2G1B cDNA ORF Clone in Cloning Vector, Human HG10865-M
    PLA2G1B cDNA ORF Clone, Human, untagged HG10865-UT
    PLA2G1B cDNA ORF Clone, Human, C-GFPSpark® tag HG10865-ACG
    PLA2G1B Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10865-ACGLN
    PLA2G1B cDNA ORF Clone, Human, C-OFPSpark® tag HG10865-ACR
    PLA2G1B cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10865-CF
    PLA2G1B cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10865-NF
    PLA2G1B cDNA ORF Clone, Human, C-His tag HG10865-CH
    PLA2G1B cDNA ORF Clone, Human, N-His tag HG10865-NH
    PLA2G1B cDNA ORF Clone, Human, C-HA tag HG10865-CY
    PLA2G1B cDNA ORF Clone, Human, N-HA tag HG10865-NY
    PLA2G1B cDNA ORF Clone, Human, C-Myc tag HG10865-CM
    PLA2G1B cDNA ORF Clone, Human, N-Myc tag HG10865-NM
    PLA2G1B qPCR Primer Pairs, Human HP100755
    info info
    添加购物车成功! 添加购物车失败!