Quick Order

Mouse PRKCD Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Mouse PRKCD cDNA Clone Product Information
NCBI RefSeq:NM_011103.2
RefSeq ORF Size:2025bp
cDNA Description:Full length Clone DNA of Mus musculus protein kinase C, delta.
Gene Synonym:Pkcd, PKC[d], AI385711, PKCdelta, D14Ertd420e, Prkcd
Species:Mouse
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
References
  • Cross T, et al. (2000) PKC-delta is an apoptotic lamin kinase. Oncogene. 19(19): 2331-7.
  • Song JS, et al. (1998) Tyrosine phosphorylation-dependent and -independent associations of protein kinase C-delta with Src family kinases in the RBL-2H3 mast cell line: regulation of Src family kinase activity by protein kinase C-delta. Oncogene. 16(26): 3357-68.
  • Shanmugam M, et al. (1998) Association of PKC delta and active Src in PMA-treated MCF-7 human breast cancer cells. Oncogene. 16(13): 1649-54.
  • Size / Price
    Catalog: MG50345-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"