PILRA cDNA ORF Clone, Mouse, N-His tag

Cat: MG50234-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PILRA Reagents
CRO Services
Product recommended

All PILRA Reagents
PILRA cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
909 bp
Description
Full length Clone DNA of Mouse paired immunoglobin-like type 2 receptor alpha with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PILRA cDNA ORF Clone, Mouse, N-His tag Alternative Names
AV021745 cDNA ORF Clone, Mouse;FDF03 cDNA ORF Clone, Mouse
PILRA Background Information
Full Name
paired immunoglobin-like type 2 receptor alpha

PILRA cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PILRA cDNA ORF Clone in Cloning Vector, Mouse MG50234-M
PILRA cDNA ORF Clone, Mouse, untagged MG50234-UT
PILRA cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50234-ACG
PILRA Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50234-ACGLN
PILRA cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50234-ACR
PILRA cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50234-CF
PILRA cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50234-NF
PILRA cDNA ORF Clone, Mouse, C-His tag MG50234-CH
PILRA cDNA ORF Clone, Mouse, C-HA tag MG50234-CY
PILRA cDNA ORF Clone, Mouse, N-HA tag MG50234-NY
PILRA cDNA ORF Clone, Mouse, C-Myc tag MG50234-CM
PILRA cDNA ORF Clone, Mouse, N-Myc tag MG50234-NM
PILRA qPCR Primer Pairs, Mouse MP200079

PILRA cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PILRA cDNA ORF Clone in Cloning Vector, Human HG13791-G
PILRA cDNA ORF Clone, Human, untagged HG13791-UT
PILRA cDNA ORF Clone, Human, C-GFPSpark® tag HG13791-ACG
PILRA Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13791-ACGLN
PILRA cDNA ORF Clone, Human, C-OFPSpark® tag HG13791-ACR
PILRA cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13791-CF
PILRA cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13791-NF
PILRA cDNA ORF Clone, Human, C-His tag HG13791-CH
PILRA cDNA ORF Clone, Human, N-His tag HG13791-NH
PILRA cDNA ORF Clone, Human, C-HA tag HG13791-CY
PILRA cDNA ORF Clone, Human, N-HA tag HG13791-NY
PILRA cDNA ORF Clone, Human, C-Myc tag HG13791-CM
PILRA cDNA ORF Clone, Human, N-Myc tag HG13791-NM
PILRA qPCR Primer Pairs, Human HP102465
info info
添加购物车成功! 添加购物车失败!