PIGF cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG52848-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PIGF Reagents
CRO Services
Product recommended

All PIGF Reagents
PIGF cDNA ORF Clone, Mouse, C-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
660 bp
Description
Full length Clone DNA of Mouse phosphatidylinositol glycan anchor biosynthesis, class F with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PIGF Background Information
Full Name
phosphatidylinositol glycan anchor biosynthesis class F

PIGF cDNA ORF Clone, Rabbit, Related Products

Product Name Catalog#(PDF)
PIGF cDNA ORF Clone in Cloning Vector, Rabbit TG65134-G
PIGF cDNA ORF Clone, Rabbit, untagged TG65134-UT
PIGF cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65134-ACG
PIGF cDNA ORF Clone, Rabbit, N-GFPSpark® tag TG65134-ANG
PIGF cDNA ORF Clone, Rabbit, C-OFPSpark® tag TG65134-ACR
PIGF cDNA ORF Clone, Rabbit, N-OFPSpark® tag TG65134-ANR
PIGF cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag TG65134-CF
PIGF cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag TG65134-NF
PIGF cDNA ORF Clone, Rabbit, C-His tag TG65134-CH
PIGF cDNA ORF Clone, Rabbit, N-His tag TG65134-NH
PIGF cDNA ORF Clone, Rabbit, C-HA tag TG65134-CY
PIGF cDNA ORF Clone, Rabbit, N-HA tag TG65134-NY
PIGF cDNA ORF Clone, Rabbit, C-Myc tag TG65134-CM
PIGF cDNA ORF Clone, Rabbit, N-Myc tag TG65134-NM

PIGF cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PIGF cDNA ORF Clone in Cloning Vector, Mouse MG52848-G
PIGF cDNA ORF Clone, Mouse, untagged MG52848-UT
PIGF Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52848-ACGLN
PIGF cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52848-ACG
PIGF cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52848-ANG
PIGF cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52848-ACR
PIGF cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52848-ANR
PIGF cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52848-CF
PIGF cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52848-NF
PIGF cDNA ORF Clone, Mouse, C-His tag MG52848-CH
PIGF cDNA ORF Clone, Mouse, N-His tag MG52848-NH
PIGF cDNA ORF Clone, Mouse, C-HA tag MG52848-CY
PIGF cDNA ORF Clone, Mouse, N-HA tag MG52848-NY
PIGF cDNA ORF Clone, Mouse, N-Myc tag MG52848-NM

PIGF cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PIGF cDNA ORF Clone, Human, untagged HG19882-UT
info info
添加购物车成功! 添加购物车失败!