PIGC cDNA ORF Clone, Mouse, C-His tag

Cat: MG52430-CH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All PIGC Reagents
CRO Services
Product recommended

All PIGC Reagents
PIGC cDNA ORF Clone, Mouse, C-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
894 bp
Description
Full length Clone DNA of Mouse phosphatidylinositol glycan anchor biosynthesis, class C with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PIGC cDNA ORF Clone, Mouse, C-His tag Alternative Names
3110030E07Rik cDNA ORF Clone, Mouse;AW212108 cDNA ORF Clone, Mouse
PIGC Background Information
Full Name
phosphatidylinositol glycan anchor biosynthesis class C

PIGC cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
PIGC cDNA ORF Clone in Cloning Vector, Rat RG89825-U
PIGC Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG89825-ACGLN

PIGC cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PIGC cDNA ORF Clone in Cloning Vector, Mouse MG52430-G
PIGC cDNA ORF Clone, Mouse, untagged MG52430-UT
PIGC cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52430-ACG
PIGC Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52430-ACGLN
PIGC cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52430-ANG
PIGC cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52430-ACR
PIGC cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52430-ANR
PIGC cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52430-CF
PIGC cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52430-NF
PIGC cDNA ORF Clone, Mouse, N-His tag MG52430-NH
PIGC cDNA ORF Clone, Mouse, C-HA tag MG52430-CY
PIGC cDNA ORF Clone, Mouse, N-HA tag MG52430-NY
PIGC cDNA ORF Clone, Mouse, C-Myc tag MG52430-CM
PIGC cDNA ORF Clone, Mouse, N-Myc tag MG52430-NM
PIGC qPCR Primer Pairs, Mouse MP202303

PIGC cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PIGC cDNA ORF Clone in Cloning Vector, Human HG14059-G
PIGC cDNA ORF Clone, Human, untagged HG14059-UT
PIGC Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14059-ACGLN
PIGC cDNA ORF Clone, Human, C-GFPSpark® tag HG14059-ACG
PIGC cDNA ORF Clone, Human, N-GFPSpark® tag HG14059-ANG
PIGC cDNA ORF Clone, Human, C-OFPSpark® tag HG14059-ACR
PIGC cDNA ORF Clone, Human, N-OFPSpark® tag HG14059-ANR
PIGC cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14059-CF
PIGC cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14059-NF
PIGC cDNA ORF Clone, Human, C-His tag HG14059-CH
PIGC cDNA ORF Clone, Human, N-His tag HG14059-NH
PIGC cDNA ORF Clone, Human, C-HA tag HG14059-CY
PIGC cDNA ORF Clone, Human, N-HA tag HG14059-NY
PIGC cDNA ORF Clone, Human, C-Myc tag HG14059-CM
PIGC cDNA ORF Clone, Human, N-Myc tag HG14059-NM
PIGC qPCR Primer Pairs, Human HP102715
info info
添加购物车成功! 添加购物车失败!