PHAX cDNA ORF Clone, Mouse, C-His tag

Cat: MG52363-CH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All PHAX Reagents
CRO Services
Product recommended

All PHAX Reagents
PHAX cDNA ORF Clone, Mouse, C-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1158 bp
Description
Full length Clone DNA of Mouse phosphorylated adaptor for RNA export with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PHAX cDNA ORF Clone, Mouse, C-His tag Alternative Names
2810055C14Rik cDNA ORF Clone, Mouse;4933427L19Rik cDNA ORF Clone, Mouse;AU018701 cDNA ORF Clone, Mouse;AU018854 cDNA ORF Clone, Mouse;D18Ertd65e cDNA ORF Clone, Mouse;p55 cDNA ORF Clone, Mouse;Rnuxa cDNA ORF Clone, Mouse
PHAX Background Information
Full Name
phosphorylated adaptor for RNA export

PHAX cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PHAX cDNA ORF Clone in Cloning Vector, Mouse MG52363-G
PHAX cDNA ORF Clone, Mouse, untagged MG52363-UT
PHAX Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52363-ACGLN
PHAX cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52363-ACG
PHAX cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52363-ANG
PHAX cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52363-ACR
PHAX cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52363-ANR
PHAX cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52363-CF
PHAX cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52363-NF
PHAX cDNA ORF Clone, Mouse, N-His tag MG52363-NH
PHAX cDNA ORF Clone, Mouse, C-HA tag MG52363-CY
PHAX cDNA ORF Clone, Mouse, N-HA tag MG52363-NY
PHAX cDNA ORF Clone, Mouse, C-Myc tag MG52363-CM
PHAX cDNA ORF Clone, Mouse, N-Myc tag MG52363-NM
PHAX qPCR Primer Pairs, Mouse MP202236

PHAX cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PHAX cDNA ORF Clone in Cloning Vector, Human HG16879-U
PHAX cDNA ORF Clone, Human, untagged HG16879-UT
PHAX Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16879-ACGLN
PHAX cDNA ORF Clone, Human, C-GFPSpark® tag HG16879-ACG
PHAX cDNA ORF Clone, Human, N-GFPSpark® tag HG16879-ANG
PHAX cDNA ORF Clone, Human, C-OFPSpark® tag HG16879-ACR
PHAX cDNA ORF Clone, Human, N-OFPSpark® tag HG16879-ANR
PHAX cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16879-CF
PHAX cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16879-NF
PHAX cDNA ORF Clone, Human, C-His tag HG16879-CH
PHAX cDNA ORF Clone, Human, N-His tag HG16879-NH
PHAX cDNA ORF Clone, Human, C-HA tag HG16879-CY
PHAX cDNA ORF Clone, Human, N-HA tag HG16879-NY
PHAX cDNA ORF Clone, Human, C-Myc tag HG16879-CM
PHAX cDNA ORF Clone, Human, N-Myc tag HG16879-NM
info info
添加购物车成功! 添加购物车失败!