PGPEP1 cDNA ORF Clone, Mouse, N-His tag

Cat: MG52970-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PGPEP1 Reagents
CRO Services
Product recommended

All PGPEP1 Reagents
PGPEP1 cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
630 bp
Description
Full length Clone DNA of Mouse pyroglutamyl-peptidase I with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PGPEP1 cDNA ORF Clone, Mouse, N-His tag Alternative Names
2810003H13Rik cDNA ORF Clone, Mouse;Gm19458 cDNA ORF Clone, Mouse;PAP-I cDNA ORF Clone, Mouse;Pcp cDNA ORF Clone, Mouse;PGP cDNA ORF Clone, Mouse;PGP-I cDNA ORF Clone, Mouse;PGPI cDNA ORF Clone, Mouse
PGPEP1 Background Information
Full Name
pyroglutamyl-peptidase I

PGPEP1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PGPEP1 cDNA ORF Clone in Cloning Vector, Mouse MG52970-G
PGPEP1 cDNA ORF Clone, Mouse, untagged MG52970-UT
PGPEP1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52970-ACGLN
PGPEP1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52970-ACG
PGPEP1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52970-ANG
PGPEP1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52970-ACR
PGPEP1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52970-ANR
PGPEP1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52970-CF
PGPEP1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52970-NF
PGPEP1 cDNA ORF Clone, Mouse, C-His tag MG52970-CH
PGPEP1 cDNA ORF Clone, Mouse, C-HA tag MG52970-CY
PGPEP1 cDNA ORF Clone, Mouse, N-HA tag MG52970-NY
PGPEP1 cDNA ORF Clone, Mouse, C-Myc tag MG52970-CM
PGPEP1 cDNA ORF Clone, Mouse, N-Myc tag MG52970-NM

PGPEP1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PGPEP1 cDNA ORF Clone in Cloning Vector, Human HG22290-G
PGPEP1 cDNA ORF Clone, Human, untagged HG22290-UT
PGPEP1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG22290-ACGLN
PGPEP1 cDNA ORF Clone, Human, C-GFPSpark® tag HG22290-ACG
PGPEP1 cDNA ORF Clone, Human, N-GFPSpark® tag HG22290-ANG
PGPEP1 cDNA ORF Clone, Human, C-OFPSpark® tag HG22290-ACR
PGPEP1 cDNA ORF Clone, Human, N-OFPSpark® tag HG22290-ANR
PGPEP1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG22290-CF
PGPEP1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG22290-NF
PGPEP1 cDNA ORF Clone, Human, C-His tag HG22290-CH
PGPEP1 cDNA ORF Clone, Human, N-His tag HG22290-NH
PGPEP1 cDNA ORF Clone, Human, C-HA tag HG22290-CY
PGPEP1 cDNA ORF Clone, Human, N-HA tag HG22290-NY
PGPEP1 cDNA ORF Clone, Human, C-Myc tag HG22290-CM
PGPEP1 cDNA ORF Clone, Human, N-Myc tag HG22290-NM
info info
添加购物车成功! 添加购物车失败!