PGK1 cDNA ORF Clone, Mouse, C-HA tag

Cat: MG50628-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PGK1 Reagents
CRO Services
Product recommended

All PGK1 Reagents
PGK1 cDNA ORF Clone, Mouse, C-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1254 bp
Description
Full length Clone DNA of Mouse phosphoglycerate kinase 1 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PGK1 cDNA ORF Clone, Mouse, C-HA tag Alternative Names
Pgk-1 cDNA ORF Clone, Mouse
PGK1 Background Information
Full Name
phosphoglycerate kinase 1
References
  • Rush J. et al., 2005, Nat Biotechnol. 23: 94-101.
  • Olsen JV. et al., 2006, Cell. 127: 635-648.
  • Zieker D. et al., 2008, Cell Physiol Biochem. 21 (5-6): 429-36.
  • Jung Y. et al., 2009, Mol Cancer Res. 7 (10): 1595-604.
  • Choudhary C. et al., 2009, Science. 325: 834-40.
  • PGK1 cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    PGK1 cDNA ORF Clone in Cloning Vector, Canine DG70189-U
    PGK1 cDNA ORF Clone, Canine, untagged DG70189-UT
    PGK1 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70189-ACGLN
    PGK1 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70189-ACG
    PGK1 cDNA ORF Clone, Canine, N-GFPSpark® tag DG70189-ANG
    PGK1 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70189-ACR
    PGK1 cDNA ORF Clone, Canine, N-OFPSpark® tag DG70189-ANR
    PGK1 cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70189-CF
    PGK1 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70189-NF
    PGK1 cDNA ORF Clone, Canine, C-His tag DG70189-CH
    PGK1 cDNA ORF Clone, Canine, N-His tag DG70189-NH
    PGK1 cDNA ORF Clone, Canine, C-HA tag DG70189-CY
    PGK1 cDNA ORF Clone, Canine, N-HA tag DG70189-NY
    PGK1 cDNA ORF Clone, Canine, C-Myc tag DG70189-CM
    PGK1 cDNA ORF Clone, Canine, N-Myc tag DG70189-NM

    PGK1 cDNA ORF Clone, Ferret, Related Products

    Product Name Catalog#(PDF)
    PGK1 cDNA ORF Clone in Cloning Vector, Ferret FG60133-G
    PGK1 cDNA ORF Clone, Ferret, untagged FG60133-UT
    PGK1 Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60133-ACGLN
    PGK1 cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60133-ACG
    PGK1 cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60133-ANG
    PGK1 cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60133-ACR
    PGK1 cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60133-ANR
    PGK1 cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60133-CF
    PGK1 cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60133-NF
    PGK1 cDNA ORF Clone, Ferret, C-His tag FG60133-CH
    PGK1 cDNA ORF Clone, Ferret, N-His tag FG60133-NH
    PGK1 cDNA ORF Clone, Ferret, C-HA tag FG60133-CY
    PGK1 cDNA ORF Clone, Ferret, N-HA tag FG60133-NY
    PGK1 cDNA ORF Clone, Ferret, C-Myc tag FG60133-CM
    PGK1 cDNA ORF Clone, Ferret, N-Myc tag FG60133-NM

    PGK1 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    PGK1 cDNA ORF Clone in Cloning Vector, Rat RG80663-U
    PGK1 cDNA ORF Clone, Rat, untagged RG80663-UT
    PGK1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80663-ACGLN
    PGK1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80663-ACG
    PGK1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80663-ANG
    PGK1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80663-ACR
    PGK1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80663-ANR
    PGK1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80663-CF
    PGK1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80663-NF
    PGK1 cDNA ORF Clone, Rat, C-His tag RG80663-CH
    PGK1 cDNA ORF Clone, Rat, N-His tag RG80663-NH
    PGK1 cDNA ORF Clone, Rat, C-HA tag RG80663-CY
    PGK1 cDNA ORF Clone, Rat, N-HA tag RG80663-NY
    PGK1 cDNA ORF Clone, Rat, C-Myc tag RG80663-CM
    PGK1 cDNA ORF Clone, Rat, N-Myc tag RG80663-NM
    PGK1 qPCR Primer Pairs, Rat RP300627

    PGK1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    PGK1 cDNA ORF Clone in Cloning Vector, Mouse MG50628-M
    PGK1 cDNA ORF Clone, Mouse, untagged MG50628-UT
    PGK1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50628-ACG
    PGK1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50628-ACGLN
    PGK1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50628-ANG
    PGK1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50628-ACR
    PGK1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50628-ANR
    PGK1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50628-CF
    PGK1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50628-NF
    PGK1 cDNA ORF Clone, Mouse, C-His tag MG50628-CH
    PGK1 cDNA ORF Clone, Mouse, N-His tag MG50628-NH
    PGK1 cDNA ORF Clone, Mouse, N-HA tag MG50628-NY
    PGK1 cDNA ORF Clone, Mouse, C-Myc tag MG50628-CM
    PGK1 cDNA ORF Clone, Mouse, N-Myc tag MG50628-NM
    PGK1 qPCR Primer Pairs, Mouse MP200611

    PGK1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    PGK1 cDNA ORF Clone in Cloning Vector, Human HG11114-M
    PGK1 cDNA ORF Clone, Human, untagged HG11114-UT
    PGK1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11114-ACGLN
    PGK1 cDNA ORF Clone, Human, C-GFPSpark® tag HG11114-ACG
    PGK1 cDNA ORF Clone, Human, N-GFPSpark® tag HG11114-ANG
    PGK1 cDNA ORF Clone, Human, C-OFPSpark® tag HG11114-ACR
    PGK1 cDNA ORF Clone, Human, N-OFPSpark® tag HG11114-ANR
    PGK1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11114-CF
    PGK1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11114-NF
    PGK1 cDNA ORF Clone, Human, C-His tag HG11114-CH
    PGK1 cDNA ORF Clone, Human, N-His tag HG11114-NH
    PGK1 cDNA ORF Clone, Human, C-HA tag HG11114-CY
    PGK1 cDNA ORF Clone, Human, N-HA tag HG11114-NY
    PGK1 cDNA ORF Clone, Human, C-Myc tag HG11114-CM
    PGK1 cDNA ORF Clone, Human, N-Myc tag HG11114-NM
    PGK1 qPCR Primer Pairs, Human HP100009
    info info
    添加购物车成功! 添加购物车失败!