After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse PFK1/PFKM Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Mouse PFKM cDNA Clone Product Information
NCBI RefSeq:NM_001163487.1
RefSeq ORF Size:2343bp
cDNA Description:Full length Clone DNA of Mus musculus phosphofructokinase, muscle.
Gene Synonym:Pfk4, Pfka, Pfkx, PFK-A, PFK-M, Pfk-4, AI131669
Species:Mouse
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

PFK1, also known as PFKM, is a regulatory glycolytic enzyme. PFK1 converts fructose 6-phosphate and ATP into fructose 1,6-bisphosphate (through PFK-1), fructose 2,6-bisphosphate (through PFK-2) and ADP. It is a muscle-type isozyme. There are three phosphofructokinase isozymes in humans: muscle, liver and platelet. These isozymes function as subunits of the mammalian tetramer phosphofructokinase, which catalyzes the phosphorylation of fructose-6-phosphate to fructose-1,6-bisphosphate. Mutations in PFK1 gene have been related with glycogen storage disease type VII, also identified as Tarui disease.

Size / Price
Catalog: MG52541-UT
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
Availability2-3 weeks
Bulk Discount InquiryAdd to Cart
Contact Us
Images
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"