PFKL cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG52702-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PFKL Reagents
CRO Services
Product recommended

All PFKL Reagents
PFKL cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2343 bp
Description
Full length Clone DNA of Mouse phosphofructokinase, liver, B-type with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PFKL cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
AA407869 cDNA ORF Clone, Mouse;ATP-PFK cDNA ORF Clone, Mouse;PFK-L cDNA ORF Clone, Mouse
PFKL Background Information
Full Name
phosphofructokinase, liver

PFKL cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PFKL cDNA ORF Clone in Cloning Vector, Mouse MG52702-G
PFKL cDNA ORF Clone, Mouse, untagged MG52702-UT
PFKL Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52702-ACGLN
PFKL cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52702-ACG
PFKL cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52702-ANG
PFKL cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52702-ACR
PFKL cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52702-ANR
PFKL cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52702-CF
PFKL cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52702-NF
PFKL cDNA ORF Clone, Mouse, C-His tag MG52702-CH
PFKL cDNA ORF Clone, Mouse, N-His tag MG52702-NH
PFKL cDNA ORF Clone, Mouse, C-HA tag MG52702-CY
PFKL cDNA ORF Clone, Mouse, N-HA tag MG52702-NY
PFKL cDNA ORF Clone, Mouse, C-Myc tag MG52702-CM
PFKL qPCR Primer Pairs, Mouse MP202573

PFKL cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PFKL cDNA ORF Clone in Cloning Vector, Human HG14223-G
PFKL cDNA ORF Clone, Human, untagged HG14223-UT
PFKL Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14223-ACGLN
PFKL cDNA ORF Clone, Human, C-GFPSpark® tag HG14223-ACG
PFKL cDNA ORF Clone, Human, N-GFPSpark® tag HG14223-ANG
PFKL cDNA ORF Clone, Human, C-OFPSpark® tag HG14223-ACR
PFKL cDNA ORF Clone, Human, N-OFPSpark® tag HG14223-ANR
PFKL cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14223-CF
PFKL cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14223-NF
PFKL cDNA ORF Clone, Human, C-His tag HG14223-CH
PFKL cDNA ORF Clone, Human, N-His tag HG14223-NH
PFKL cDNA ORF Clone, Human, C-HA tag HG14223-CY
PFKL cDNA ORF Clone, Human, N-HA tag HG14223-NY
PFKL cDNA ORF Clone, Human, C-Myc tag HG14223-CM
PFKL cDNA ORF Clone, Human, N-Myc tag HG14223-NM
PFKL qPCR Primer Pairs, Human HP102873
info info
添加购物车成功! 添加购物车失败!