PEX3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag

Cat: MG52087-NF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All PEX3 Reagents
CRO Services
Product recommended

All PEX3 Reagents
PEX3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1119 bp
Description
Full length Clone DNA of Mouse peroxisomal biogenesis factor 3 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PEX3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag Alternative Names
1700014F15Rik cDNA ORF Clone, Mouse;2810027F19Rik cDNA ORF Clone, Mouse;2900010N04Rik cDNA ORF Clone, Mouse
PEX3 Background Information
Full Name
peroxisomal biogenesis factor 3

PEX3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PEX3 cDNA ORF Clone in Cloning Vector, Mouse MG52087-G
PEX3 cDNA ORF Clone, Mouse, untagged MG52087-UT
PEX3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52087-ACG
PEX3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52087-ACGLN
PEX3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52087-ANG
PEX3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52087-ACR
PEX3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52087-ANR
PEX3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52087-CF
PEX3 cDNA ORF Clone, Mouse, C-His tag MG52087-CH
PEX3 cDNA ORF Clone, Mouse, N-His tag MG52087-NH
PEX3 cDNA ORF Clone, Mouse, C-HA tag MG52087-CY
PEX3 cDNA ORF Clone, Mouse, N-HA tag MG52087-NY
PEX3 cDNA ORF Clone, Mouse, C-Myc tag MG52087-CM
PEX3 cDNA ORF Clone, Mouse, N-Myc tag MG52087-NM
PEX3 qPCR Primer Pairs, Mouse MP201960

PEX3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PEX3 cDNA ORF Clone in Cloning Vector, Human HG14106-G
PEX3 cDNA ORF Clone, Human, untagged HG14106-UT
PEX3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14106-ACGLN
PEX3 cDNA ORF Clone, Human, C-GFPSpark® tag HG14106-ACG
PEX3 cDNA ORF Clone, Human, N-GFPSpark® tag HG14106-ANG
PEX3 cDNA ORF Clone, Human, C-OFPSpark® tag HG14106-ACR
PEX3 cDNA ORF Clone, Human, N-OFPSpark® tag HG14106-ANR
PEX3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14106-CF
PEX3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14106-NF
PEX3 cDNA ORF Clone, Human, C-His tag HG14106-CH
PEX3 cDNA ORF Clone, Human, N-His tag HG14106-NH
PEX3 cDNA ORF Clone, Human, C-HA tag HG14106-CY
PEX3 cDNA ORF Clone, Human, N-HA tag HG14106-NY
PEX3 cDNA ORF Clone, Human, C-Myc tag HG14106-CM
PEX3 cDNA ORF Clone, Human, N-Myc tag HG14106-NM
PEX3 qPCR Primer Pairs, Human HP102759
info info
添加购物车成功! 添加购物车失败!