PEPD cDNA ORF Clone, Mouse, C-His tag

Cat: MG52426-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PEPD Reagents
CRO Services
Product recommended

All PEPD Reagents
PEPD cDNA ORF Clone, Mouse, C-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1482 bp
Description
Full length Clone DNA of Mouse peptidase D with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PEPD cDNA ORF Clone, Mouse, C-His tag Alternative Names
dal cDNA ORF Clone, Mouse;Pep-4 cDNA ORF Clone, Mouse;Pep4 cDNA ORF Clone, Mouse
PEPD Background Information
Full Name
peptidase D

PEPD cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
PEPD cDNA ORF Clone in Cloning Vector, Rat RG81514-G

PEPD cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PEPD cDNA ORF Clone in Cloning Vector, Mouse MG52426-G
PEPD cDNA ORF Clone, Mouse, untagged MG52426-UT
PEPD cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52426-ACG
PEPD Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52426-ACGLN
PEPD cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52426-ANG
PEPD cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52426-ACR
PEPD cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52426-ANR
PEPD cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52426-CF
PEPD cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52426-NF
PEPD cDNA ORF Clone, Mouse, N-His tag MG52426-NH
PEPD cDNA ORF Clone, Mouse, C-HA tag MG52426-CY
PEPD cDNA ORF Clone, Mouse, N-HA tag MG52426-NY
PEPD cDNA ORF Clone, Mouse, C-Myc tag MG52426-CM
PEPD cDNA ORF Clone, Mouse, N-Myc tag MG52426-NM
PEPD qPCR Primer Pairs, Mouse MP202299

PEPD cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PEPD cDNA ORF Clone in Cloning Vector, Human HG14525-G
PEPD cDNA ORF Clone, Human, untagged HG14525-UT
PEPD Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14525-ACGLN
PEPD cDNA ORF Clone, Human, C-GFPSpark® tag HG14525-ACG
PEPD cDNA ORF Clone, Human, N-GFPSpark® tag HG14525-ANG
PEPD cDNA ORF Clone, Human, C-OFPSpark® tag HG14525-ACR
PEPD cDNA ORF Clone, Human, N-OFPSpark® tag HG14525-ANR
PEPD cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14525-CF
PEPD cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14525-NF
PEPD cDNA ORF Clone, Human, C-His tag HG14525-CH
PEPD cDNA ORF Clone, Human, N-His tag HG14525-NH
PEPD cDNA ORF Clone, Human, C-HA tag HG14525-CY
PEPD cDNA ORF Clone, Human, N-HA tag HG14525-NY
PEPD cDNA ORF Clone, Human, C-Myc tag HG14525-CM
PEPD cDNA ORF Clone, Human, N-Myc tag HG14525-NM
PEPD qPCR Primer Pairs, Human HP103172
info info
添加购物车成功! 添加购物车失败!